Query (optional)   in Class  

GrainGenes Sequence Report: Y00417

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y00417
Subsequence
Y00417_1.cds2291803
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277157
Data at Gramene
Gramene-Protein P68539
DB Remark
Locus Source: mitochondrion Triticum aestivum (bread wheat)
Keyword
cytochrome oxidase I
Species
Triticum aestivum
Cultivar
Thatcher
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Wheat mitochondrial COI gene for cytochrome oxidase subunit I.
Strain
var. Thatcher
Remark
DB_xref: taxon:4565
Feature: source: organelle = 'mitochondrion'; mol_type = 'genomic DNA';
Feature: source: organelle = 'mitochondrion'; mol_type = 'genomic DNA'
DNA
aagcttctcaaaagcatccagaaatatcatagaatggtgatcgagatcac
cttcacgggaatcatcctttgcaaattgggggaagggaaccaatcaagtc
accaagaagttcccgaaacttggtttagtattaaggttcttctcttccag
cgtttagtattcaagttcttctcttccagccccccggcccctctttgata
aggaaagtttgcatttctcaaataaaaaatgacaaatatggttcgatggc
tcttctctactaaccacaaggatattgggactctctatttcatcttcggt
gccattgcaggagtgatgggcacatgcttctccgtactgattcgtatgga
attagcccgacccggcgatcaaattcttggtgggaatcatcaactttata
atgttttaataacggctcatgcttttttaatgatcttttttatggttatg
ccggcgatgataggtggatttggtaattggtttgttccgattctgatagg
tgcacctgacatggcatttccacgattaaataatatatcattctggttgt
tgccaccaagtctcttgctcctattaagctcagccttagtagaagtgggc
agcggcactgggtggacagtctatccgcccttaagtggtattaccagcca
ttctggaggagcagttgatttagcaatttttagtcttcatctatcaggta
tttcatcaattttaggttctatcaattttataacaactatcttcaacatg
cgtggacctggaatgactatgcatagattaccactttttgtgtggtccgt
tctagtgacagcattcctacttttattatcacttccggtactggcggggg
caattacaatgttattaaccgatcgaaactttaatacaaccttttttgat
cctgcaggagggggagacccaatattataccagcatctcttttggttctt
cggtcatccagaggtgtatattctcattctgcctggatttggtattatta
gtcatatcgtatcgaccttttcaagaaaaccggtcttcgggtatctaggc
atggtttatgccatgataagtataggtgttcttggatttctagtttgggc
tcatcatatgtttactgtgggcttagacgttgatacgcgtgcctacttca
ccgcagctaccatgatcatagctgtgcccacaggaatcaaaatctttagt
tggatcgctaccatgtggggaggttcgatacaatacaaaacacccatgtt
atttgctgtagggttcatctttttgttcaccataggagggctcactggaa
tagttctagcaaactctgggctagacattgctctacatgatacttattat
gtggttgcacatttccattatgtactttctatgggagccgtttttgcttt
atttgctggattttactattgggtgggtaaaatctttggtcggacatatc
ctgaaactttaggccaaatccatttttggatcacttttttcggggttaat
ctgaccttctttcccatgcatttcttagggctttcgggtatgccacgtcg
cattccagattatccagatgcttacgccggatggaatgctctgagcagtt
tcggttcttatatatccgtagttgggattcgtcgtttcttcgtagttgtc
gcaatcacttcaagcagtggaaagaaccaaaaatgtgcggaaagtccttg
ggctgttgaacagaatccaaccacactagaatggttggtacaaagccctc
cggcctttcatacttttggagaacttcctgcggtaaaagagacaaaaagc
taaaaaaaaacctctcctaactatgaaggaagtttcatagagataggtgt
ggggaaataagttcttcatttgaagagttag
BLAST
BLAST Search