Query (optional)   in Class  

GrainGenes Sequence Report: Y00520

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y00520
Subsequence
Y00520_1.cds157507
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC344108
Data at Gramene
Gramene-Protein P07924
DB Remark
Locus Source: mitochondrion Triticum aestivum (bread wheat)
Keyword
mitochondrial DNA
ribosomal protein S13
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat mitochondrial DNA for ribosomal protein S13.
Remark
DB_xref: taxon:4565
Feature: source: organelle = 'mitochondrion'; mol_type = 'genomic DNA';
Locus Comment: Data kindly reviewed (16-May-1988) by Bonen L.
DNA
tgaataaaaacgaggagccgaagattctagggggctacagctgcgctttt
gcagcactgaacatggttccgggtactcaagatattgcgtttgtgtttgg
agaggtgtagattgtagattccagccgagaagaccaggaaaagataagga
taaagaatgtcatatatctcaggagctagatcacttcccgatgaacaagt
aagaattgcctcaacaaaaatggatggaattggaccgaaaaaagccattc
agcttcgttatcgattaggtatcagtgggaacatcaagatgaatgagtta
actaagtatcagatcgaccaaattgaacaaatgatagctcaagatcatgt
tgttcattgggaattgaagaggggagaacgagcagacatcgaacgattaa
tttctatttctcgttatcgtggaattcgtcatcaagatggatcgccctta
cgcggtcaacgaactcatactaatgcaaggactgctcgcaagcaaattcg
gaaatgaaagaaggctaccgaaagaacaagcaacggatttcgcgctcatc
ccttgctaaagcgcatacgttttcttgctccttggtacttgtctgatcaa
tcacactgttcattagttcacttgatttttcgttcgatgtcttgaaccgc
ttactaatcacgtatacgtatagtaggcccccttcgccactccacgtctg
gcccgtcttggtctcgctcacttcgcccgcctatcgtatcggctcggctt
cgtccgtcaagcgacagcttctgcctctgacggcttcactatcgctcatg
actggtagtactctatgtagtagtcggcctttgttaagctt
BLAST
BLAST Search