Query (optional)   in Class  

GrainGenes Sequence Report: Y00704

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y00704
Subsequence
Y00704_1.cds51518
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC181613
NCBI UniGene
Hv.12781
Data at Gramene
Gramene-Protein P08248
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Plastocyanin precursor'
Keyword
plastocyanin
transit peptide
Species
Hordeum vulgare
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Barley mRNA for plastocyanin precursor.
Clone
pKG1409,pKG3541,pKG4438,pKG755,pKG951
Probe
pKG4438
Gene Product
plastocyanin precursor
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
EMBL Feature
mat_peptide225515(AA 59-155)Location: 225..515
polyA_site662662polyA siteLocation: 662
transit_peptide51224(AA 1-58)Location: 51..224
DNA
aacacttggctaggctagctctcctcctctgcagtacgtagcaagcagcc
atggccgccctctcctctgcagccgtgtccgtcccttccttcgccgccgc
cacccccatgcgcagcagcagaagcagcaggatggttgtgcgcgcttccc
tgggcaagaaggccgccagcgcggccgtggccatggccgccggcgccatg
ctgctgggcgggtccgcgatggcacaggacgtgctcctgggtgccaacgg
cggcgtgctggtgttcgagcccaacgacttcagcgtcaaggccggcgaga
ccatcaccttcaagaacaacgccgggtacccgcacaacgtggtgttcgac
gaggacgccgtgccctccggcgtcgacgtctccaagatctcccaggagga
gtacctcaacgcccccggcgagaccttctccgtcaccctcaccgtccccg
gcacctacggcttctactgcgagccccacgctggggccggcatggtcgga
aaggtcaccgtcaactaatgaagctaccaatttgggtcgattgatcgctc
aaattggacgtgtcgtgcatgcatcatattgattaattgtacgctatatg
tatgtatatgttttctactctactctactctactctataagatcgatgag
gctcttcgtgat
BLAST
BLAST Search