Query (optional)   in Class  

GrainGenes Sequence Report: Y00966

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y00966
Subsequence
Y00966_1.cds39482
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC173781
NCBI UniGene
Hv.3866
Data at Gramene
Gramene-Protein P13194
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Psa2 preprotein (AA -46 to 101)'
Keyword
photosystem I
psaE gene
Species
Hordeum vulgare
Clone Library
lambda gt11
Tissue
seedling
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare pot. psaE mRNA.
Gene Product
mature psa2 protein (AA 1 - 101)
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
EMBL Feature
mat_peptide177479Location: 177..479
polyA_site610610polyA siteLocation: 610
sig_peptide39176signal peptide (AA -46 to -1)Location: 39..176
DNA
ctagctagcacccacaaacagcacctgctgccgtcccgatggcgagcacc
aacatggcgtcggccacctccagattcatgctggcggcgggcatccccag
cggcgccaacggcggcgtgagcagccgtgtcagcttcctcccgtccaacc
ggctcggcttgaagctcgtggcccgggccgaggagccgactgccgccgcg
ccggcggaaccagcaccggcggcggacgagaaaccggaagccgccgtggc
caccaaagagcccgccaaagccaagccgccgccgaggggacccaagaggg
gcaccaaggtgaagatcctgaggagggagtcctactggtacaacgggact
ggatccgtcgtcacggttgatcaggatcccaacacccgttacccggtggt
ggtgcgtttcgccaaggtgaactacgccggcgtgtcgaccaacaactacg
ccctggacgagatcaaggaggttgctgcttgaacgatcgaggctgccgcg
tgctcaatccaatgtttgtatcagtagctcgtcaagtggcgatgtgaatg
ttagcctcacaaatcttatgtgtaatacctctgcgattatatgtatttgc
ctgcttcctc
BLAST
BLAST Search