Query (optional)   in Class  

GrainGenes Sequence Report: Y07550

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y07550
Subsequence
Y07550_1.cds14653080
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Claviceps purpurea (ergot fungus)
Keyword
cel1 gene
cellulose 1,4-beta-cellobiosidase precursor
Species
Claviceps purpurea
Clone Library
EMBL 3
Data Source
genbankDownloaded 2008-2009
Title
Claviceps purpurea cel1 gene for cellulose 1,4-beta-cellobiosidase precursor.
Strain
T5
Gene
cel1
Gene Product
cellulose 1,4-beta-cellobiosidase
Remark
DB_xref: taxon:5111
Feature: mat_peptide: EC_number = '3.2.1.91'
Feature: exon: gene = 'cel1';
Feature: intron: gene = 'cel1';
Feature: source: mol_type = 'genomic DNA';
EMBL Feature
mat_peptide15222076Location: join(1522..2076,2203..2769,2889..3077)
[ Show all 8 ]
DNA
ctgcagaaaggagcacataggacgtggggagtatgtcggccataggagaa
aactaccaaccaacatacctacagcatgtacgcacgacataccgtacgcg
tacgtaagaggtatgagctgaacaatggggctattctggaggacaaaacg
taatagtacccagagactgtacagcacggtcatagactcatgcataagag
actatactgctgagactgtaaaatactgagtacggccatgcagtaaatct
atacagtagagactgtataacagcacagtaaggaccatatacgcccatac
actgcaaacgccagacgttacacgtatgcacatgcgtgtgatcgcgccat
cttcgccgagcagaggacatccaaatgcaatcataacgttgctcgccgct
cacaagaggggaaagtaggaaagtagataggaaatcgggaaagcgggaac
cccgacgacttccgcatgcttgtatgtactcgtaataacgtatgatggtg
tgtttccttgggctctgatccaactcgatccctcaggcgccgtcttcaaa
gcagcatcacattcacgagttcatgcgaggcgtggagcattacctatgta
cccgtgttagcctttgggtgcctggccctggcagccttctaataagtcct
agtcctaagttctaagttctcgccggctgtgcggtccggacatagatcgc
tcggggacggccgggcctacagggattcggagccgggagtggcccactct
tggccggtacagagtccacccgtttggccgatcccgtgcccacatgacct
cggtccattccgggcatcgcagcgccaggcgctcttgttgatgaaacgtt
ttcatgcggagttgcgggctcattttgggcagagcgtttcttcttctctc
cccttcgtgccaggacgcaatggagggaatcagcttcagccttcaacgga
ccgaatcaccgatcgtggatcgtgacattcggctataatgacgcttgttg
acatatatatccacgagcttcgggacgcgcgttgcgtttacgcaccaatc
ccgatccagatgaggcagaagaatgcagcctcgggtttcatccccgtgga
atatggactcatggcacgtctcgtgaggaggaagttggaacttttgatca
ggacatgcgaatgcattcgccgtcgatgaagccttggccgggcaggcaca
ttcaggggaaatgcgtaggtacatgctcaccgatgcggccaaatcgatca
tactcttggcacatctcggcgcatctgacatagacaggacaatgttgata
tataaacccaacggacacacctgtcaaacgatattaacagcagcctcaca
atagcaacagcggcagagaaagaaacagaagagacaaaaagagtcgcaag
cctcagcagaaacaacaacacacgaaaaaaaaaagaaggtccccaggcca
ccaacatcaccaccatgcatccctccctccagaccatcctcctctccgcc
ctcttcaccaccgcccacgcccaacaagcctgctccagcaaaccggagac
gcatccccccctctcttggtctcgttgctcccgctcaggctgccggtccg
tccaaggcgccgtcaccgtcgacgccaactggctgtggacgaccgtcgac
ggctcccagaactgctacaccggcaaccgctgggacacatccatctgctc
ctccgaaaagacctgctcggagagctgctgcattgacggcgccgactatg
ccggcacgtatggcgtgaccaccaccggggatgccctgagcctgaaattc
gtgcagcagggcccgtatagcaagaatgtgggtagcaggctgtatctgat
gaaagatgagagccggtatgagatgtttaccctgctgggtaatgaattta
cgtttgatgtggatgtctcgaagctgggatgcggtctaaatggcgcactg
tactttgtgtccatggatgaagatggtggaatgaaaaggttcccgatgaa
caaggcgggtgcgaaatttggcacgggctactgcgatagtcagtgtccga
gggacgtcaagttcattaacggaatggtaagctttacggactcacgagtc
acgacagagtcgttctatttccctttttattccctcgtcgatgggttcaa
cacgcactcttgattcccatctcgtatactgattcacgatttcacatcac
aggccaactccaaagactggatcccctccaaaagcgacgccaacgccggc
atcggtagcctaggcgcctgctgccgtgaaatggacatctgggaagccaa
caacatcgcctcggccttcacaccccacccatgcaaaaacagcgcctacc
actcctgcacgggcgacggctgcggcggcacatattccaagaaccgctac
tcgggcgactgcgaccctgacggctgcgacttcaacagctaccgcctcgg
caacacgactttttacggaccgggccccaagttcaccatcgacaccaccc
gcaagatctccgtcgtgacgcagttcctcaagggccgtgatgggtccctc
cgcgagattaagcgcttctacgtccagaatgggaaagtcattcccaattc
cgtgagcagggttcgtggtgtgcctggaaactccatcacacagggattct
gtaatgcccagaagaagatgtttggggctcacgagtcgtttaatgcaaag
gggggcatgaagggcatgagtgctgcggtgtcaaagcctatggtgttggt
tatgagtctttgggatgatgtgagttttaatggccgtctttgcggaagac
aatttcccccccttccgtctttaaccccccccttttttttttattctttt
gatacagaatcgtactgatgagagatacgaaaatatagcacaactccaat
atgctctggctcgattccacctatcccactaacagccgccagcgcggaag
caagcgcggcagctgccccgcgtcctctggccgtccaaccgatgtcgaga
gttcggcccctgactcgactgtggtcttttccaacatcaagtttggtccc
atcgggtctaccttttcccgtggcaagtaaagtccgactgaacccgcctt
gtggtgacgcattaggtagtccgtccggtgtctacctgtgttggtgagcc
gagccaacttttccttattggcggcgttcgcattgttggggtaactagat
cattcgctgtattgcgctcttttttatttatttacgaaagcatcgtatat
atgaccccgtttatagtataagtcgccgccgaggatttgagaactcgaaa
ggttatacggaaagaagatagaatagcttgctggctgagcttagagagaa
tagacactcatacatacacttcttcttcgcttcgaaaaggtggccatatc
tacatctattgatgcatctttttccaccgtgtgaataccactgacgttct
ttctgcttcatcgccattctcactgttgagtttcgagaaaagatgtagcc
aattgagggtattatcatgcctatcactttgtatatccaaacatgatggt
cgctgactcggtgtaaggtacaagaacccattgacccaacctagaagata
gtccccaaagaacgacctaaaagtacagccctgtggcatgccccaagaca
aatggccgctggcaagactatgaagacaaggaattttctcgactgcattt
ctcttattcaaccacccccgttcatcatctgcgccccgtcgac
BLAST
BLAST Search