Query (optional)   in Class  

GrainGenes Sequence Report: Y07636

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y07636
Subsequence
Y07636_1.cds821788
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC310443
NCBI UniGene
Ta.639
Data at Gramene
Gramene-Protein O04843
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Peptidylprolyl isomerase'
Keyword
FKBP77 gene
peptidylprolyl isomerase
Species
Triticum aestivum
Cultivar
Atir
Clone Library
ZAP II
Tissue
root tips
Developmental Stage
2 day old plants
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
T.aestivum mRNA for peptidylprolyl isomerase.
Strain
ATIR
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Gene: FKBP77
EMBL Feature
feature_gene11999Location: 1..1999
DNA
ccccccgaacctaatcaacaatgaccgccgtggaggatgagacgctgagg
gcgttcgaagaggaggaggatgccatgatgaatgagccggacgcagccca
tggacggcctcgacgtcgacgacgaggaggaggccgactccccggcgacg
atgaaggtccgggaggagaaggagatcgggaagcagggcctgaagaagaa
gctcgtcaaggagggcgagggctgggacacggccgagaccgcattaaagg
tcgaagtgcactacacgggcactctcctcgacgggaccaagttcgattcg
agccgggaccgcgggactcccttcaagttcaagctcgagcagggccaggt
gatcaagggatgggaccagggcatcaagaccatgaagaagggcgagaacg
cgtccctcaccatcccgccggacctcgcgtacggcgagcgggctccccgc
acgatcccgcccaacgcgacgctccggttcgacgtcgagctcctctcgtg
ggccagcgtcaaggacatctgcaaggacggcggcatcttcaagaaggtcc
tggtcgagggtcagaaatgggagaatcccaaggatctcgacgaagttact
gtcaagtacgaggcgagacttgaggatggatccgtcgtgtccaagtcaga
gagcattgaattctcagtgaaggatggttacttctgcccggcactttcca
aagccgtgaagaccatgaagaagggcgagaaggtcctcctgaccgtcaag
ccacaatatggttttggcgagcaaggaagggcggctactgaagttgaagg
cgccgtgcccccgaattccacattgcacatcgatcttcagctagtttcct
ggaagacgcttaccctcatcggtgacgacaagaggatcttgaagaaggtg
ctcaaggaaggagaaggctacgagcgccccaacgatggggcagttgtcag
agtgggactgatcggcaagttggacgatggcactgtgttcacgaagaaag
gacatgaaggcgacgaaccattcgagttcaagacggacgaggagcaggtc
atccaagggctggacacgacggtgctcaccatgaagaaaggagaggaggc
gtcagctagaataccacctgaacatgcgttcggatccaccgagacgaagc
tatcaagcttgatctttgctgtggttcctcctaactcctccgtcttctat
gaagtggagcttgtttccttcgagaaggagaaagaatcttgggacttgaa
gagtaattctgagaagatcgaagcagcttctgaaaagaaagatgaaggaa
atgcgtggtttaagatgggcaagtacgccaaggcttccaagagatatgag
aaggctgcaaagtacatcgagtatgacagctccttcagcgaggatgagaa
gaagcaatccaaggcagtgaagatcagcatcaagctcaacaacgcagcgt
gcaaactgaaactcaaggattacaaagaagcagagaaaatctgctcaaag
gttttggagctggagagcacaaacgtcaaggctctgtaccggagggcgca
ggcgtacaccgagctcgtggatctggaactggcagaactagatatcaaga
aggctctggagatcgacccggacaacagggaggtgaaggttgcgtacaag
gcgttgaaggacaagctgagggagtacaacaagagggatgccaagttcta
cggcaacatgttcgccaaatggaggaagacggagaacgccgccgggaagc
aggaagcgcagcctatggccagcgacagcaccgcgtgacgggtctacggc
gtcgtggtacagccgggtctggatgcactagttttgtatcagcattgtac
cgtggtttcggttgtcttgtcctctcttctgcaccttgtgcttcgtctgt
gatcggctgcgtgccttgataatgtactcataatttgctggcgtacgatt
ctagtaaaaaagagtgtctatttcgttttaaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search