Query (optional)   in Class  

GrainGenes Sequence Report: Y07823

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y07823
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC160269
NCBI UniGene
Hv.8694
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Partial mRNA; clone cMWG0647'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
Haisa
Clone Library
Barley cultivar Haisa leaf (W.R.Hess)
Tissue
primary leaf
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
HVEST497 Barley cultivar Haisa leaf (W.R.Hess) Hordeum vulgare subsp. vulgare cDNA clone RG18, mRNA sequence.
Strain
vulgare
Clone
RG18
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: W.R. Hess; Institute of Biology/Genetics; Humboldt-University; Chaussestr. 117, D-10115 Berlin, D-10115, FRG.
Note: Vector: lambda gt11
DNA
ctccaactggcccatcggcgtcaaccgctacgagtacgaccagctccggg
cgccggttggcgggcgggtctacttcaccggggagcacaccagcgagcac
tacaatggctatgtccacggagcttatcttgcaggtatacactccgcgga
cattctgatgaacaaggccctcaacaacgtcgactttaaagtccgtccca
agtatgacgacgagctgaaagctgaggctaaatgaaggaggaagttgaga
tgccatgccagtctgctcgcatgcatcgtcatggaataaactcagacgcg
tgccacagttaacgtggaagcttttccccaagaatttgatgtgaggcgaa
atgatgtgacgttccagctttctttcgtgcctcccgtgtttggattctcc
gagagtatgtggttcctgttgaagcgttccagtgatgtaatttctcgtaa
tttgatcgaataaaaacacttggccgtcgaggcctaaagttaaaaaa
BLAST
BLAST Search