Query (optional)   in Class  

GrainGenes Sequence Report: Y07844

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y07844
Subsequence
Y07844_1.cds70522
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC154375
NCBI UniGene
Hv.306
Data at Gramene
Gramene-Protein Q96458
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'CDNA clone: FLbaf166l10, mRNA sequence'
Keyword
hsp17 gene
small heat shock protein
Species
Hordeum vulgare subsp. vulgare
Cultivar
Sundance
Clone Library
pGAD10 plasmid; seed cDNA
Tissue
seed
Developmental Stage
18-22 days post anthesis
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
H.vulgare mRNA for 17 kDa class I small heat shock protein.
Strain
vulgare
Clone
43A
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Gene: hsp17
EMBL Feature
polyA_signal715720Location: 715..720
feature_gene1748Location: 1..748
DNA
gcaaaagcagacaacaacctacctacgatcagaattttccccgagctaca
aaccaaagcagcaccgacgatgtcgatcgtgaggcgtagcaacgcgttcg
accccttcgccgacctctgggctgacccgttcgacaccttccgctccatc
gtcccggcgttctctggcaacagcgagacggccgccttcgccaatgctcg
cgtcgactggaaggagaccccggaggcgcacgtcttcaaggccgaccttc
ccggcgtgaagaaggaggaggtcaaggtggaggtggaggacggcaacgtg
ctcgttgtcagcggcgagcgcactaaggagaaggaggacaagaacgacaa
gtggcaccgcgtggagcgtagcagcggcaagttcgtgaggcgcttccgcc
tgccggaggacgccaaggtggaggaggtgaaggccggactggagaacggt
gtgctcaccgtcaccgtgcccaagacagaggtcaagaagcccgaggtgaa
ggccatcgagatctccggctgaatgcatgcgccccgacgtatactcagct
ggttggagcgagtttggttgatgtgtgcgagttctgcaacctgaaactat
gctacagttgtgtcgttgttcttgccgagtctagagagaaatctctgtat
tgtgtttctttccccagtcgtttcggtacttatgtaatcgccaacaggtg
aataataaatgagaaataaagtgtgctgattttgggtgcaaaaaaaaa
BLAST
BLAST Search