Query (optional)   in Class  

GrainGenes Sequence Report: Y08021

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y08021
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Hordeum vulgare
Keyword
centromeric repeat
Species
Hordeum vulgare
Tissue
meristemic root
Data Source
genbankRelease 144, Oct 15 2004
genbankRelease 135, Apr 15 2003
Title
H.vulgare centromeric repeat DNA.
Remark
DB_xref: taxon:4513
Feature: repeat_region: rpt_family = 'cereal centromeric repeat'
Feature: repeat_region: rpt_family = 'cereal centromeric repeat'
Feature: source: mol_type = 'genomic DNA';
Feature: source: mol_type = 'genomic DNA'
EMBL Feature
repeat_region1262Location: 1..262
DNA
ttcgaatcgtaaccgttcgtacgagacgttccttcctcctttggatcgat
gcaggatatggagattatgctcagattgttatgagttatatatttgatta
tccttttatattatgtagcgatcgctaaggcgaacgctctcacacgtttg
tagtcggatcgtcctcagtaagtgactaccaaaaccgatacccaccatct
catcgaaagacagggtcaacttcgcctctatcaacgctccctcttggagt
tacaatgtacgt
BLAST
BLAST Search