Query (optional)   in Class  

GrainGenes Sequence Report: Y08308

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y08308
Subsequence
Y08308_1.cds5355
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: mitochondrion Elymus sibiricus
Keyword
ribosomal protein S13
rps13 gene
Species
Elymus sibiricus
Developmental Stage
seedling
Data Source
genbankRelease 135, Apr 15 2003
Title
Elymus sibiricus mitochondrial gene rps13.
Strain
population Irkutskaya
Remark
DB_xref: taxon:52830
Feature: source: organelle = 'mitochondrion'; mol_type = 'genomic DNA';
Gene: rps13
Locus Comment: On Mar 22, 1999 this sequence version replaced gi:1565255.
EMBL Feature
feature_gene5355Location: 5..355
DNA
aagnatgtnatatatctnaggagctagatcacttcccgatgaacaagtca
gaattgcctcaacaaaaatggatggaattggaccgaaaaaagccattcag
cttcgttatcgattaggtatcagtnggaacatcaagatgaatgagttaac
taagtatcagatcgaccaaattgaacaaatgatagctcaagatcatgttg
ttcattgggaattgaagaggggagaacgagcagacatcgaacgattaatt
tctatttctcgttatcgtggaattcgtcatcaagatggatcgcccttacg
cggtcaacgaactcatactaatgcaaggactgctcgcaagnnnnnnnnga
aatgaaaga
BLAST
BLAST Search