Query (optional)   in Class  

GrainGenes Sequence Report: Y08490

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y08490
Subsequence
Y08490_1.cds1001455
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC156922
NCBI UniGene
Hv.12354
Data at Gramene
Gramene-Protein Q96460
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'CDNA clone: FLbaf62c24, mRNA sequence'
Keyword
alpha-tubulin 2
atub2 gene
Species
Hordeum vulgare subsp. vulgare
Cultivar
Igri
Clone Library
HV11-3_P1S1
Tissue
leaf
Developmental Stage
seedling
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
H.vulgare mRNA for alpha-tubulin 2.
Strain
vulgare
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Gene: atub2
Locus Comment: On Oct 25, 1996 this sequence version replaced gi:1619296.
EMBL Feature
feature_gene11708Location: 1..1708
DNA
ggaaaggcgtcttcgtactcgcctctctccgcgcacacgagctctcgccc
ccttcctccaacccatctcgccagcggcgcagcccaaccacccgccacaa
tgagggagtgcatctcgatccacatcggccaggccggcatccaggtcgga
aacgcgtgctgggagctctactgcctcgagcatggcattcagcctgatgg
tcagatgcccggtgacaagaccgttgggggaggtgatgatgctttcaaca
ccttcttcagcgagactggtgctgggaagcacgtcccccgtgcagtcttt
gttgatcttgagcctactgtgattgatgaggtgaggactggtgcttaccg
ccagctcttccaccctgagcagcttatcagtggcaaggaggatgcagcca
acaacttcgcccgtggtcattacaccattggcaaggagattgttgatctg
tgccttgaccgtatcaggaagctgtccgacaactgcactggtctccaggg
cttccttgtcttcaatgctgttggaggtggaactggctctggccttggtt
ctcttctcctagagcgtctctctgttgactatggaaagaagtccaagctt
gggttcacagtgtacccatctccccaggtgtccacctctgttgttgagcc
atacaacagtgtcctgtccacccactccctccttgagcacaccgatgtct
ctatcctgcttgacaatgaggccatctatgacatctgccgccgctccctt
gacattgagcgcccaacatacaccaacctcaacaggcttgtttctcaggt
catatcatcactgactgcttccctgaggtttgacggtgctctgaatgttg
atgtgaatgagttccaaaccaacctggtgccctacccaaggatccacttc
atgctttcctcctatgccccagtgatatcagcagagaaggcttaccatga
gcagctgtctgttgccgagatcaccaacagtgcattcgagccttcctcca
tgatggccaagtgtgacccccgccatggcaagtacatggcctgctgtctc
atgtaccgtggggatgtcgtgcccaaggacgtcaacgctgctgtggccac
catcaagaccaagcgcactatccagtttgttgactggtgccccactggct
tcaagtgcggtatcaactaccagccacctggtgtcgtcccagggggcgac
cttgccaaggtccagagggctgtgtgcatgatctccaactccaccagtgt
tgttgaggtcttctcccgcatcgaccacaagtttgacctgatgtacgcca
agcgtgcctttgtccactggtatgtgggtgagggtatggaggagggagag
ttctctgaggcccgtgaggaccttgctgccctggagaaggactatgaaga
agttggtgctgagttcgacgatggtgaggatggtgacgagggtgatgagt
actagagcctgcctcctggtgctttcccaaggcgtactactgctatccta
tgatctgcccaagcggctttatctgttatctgtctgtttgaatgtttgct
ttgtggtgtttgttttacaacctgttgtgttgtaagaacatattggtctg
tctgaacctaatgttatgtgcatgcggttatctatgccttggcctctgtc
tccattttcctgtttcaatatgtgttactatctggttaaaaaaaaaaaaa
aaaaaaaa
BLAST
BLAST Search