Query (optional)   in Class  

GrainGenes Sequence Report: Y08625

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y08625
Subsequence
Y08625_1.cds57263
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC168801
NCBI UniGene
Hv.23831
Data at Gramene
Gramene-Protein Q96465
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Subtilisin-chymotrypsin inhibitor 2'
Keyword
proteinase inhibitor
subtilisin-chymotrypsin inhibitor
Species
Hordeum vulgare subsp. vulgare
Cultivar
Carina
Tissue
leaf
Developmental Stage
senescent
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
H.vulgare mRNA for subtilisin-chymotrypsin inhibitor 2.
Strain
vulgare
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
EMBL Feature
polyA_signal272277putativeLocation: 272..277
polyA_site516516Location: 516
DNA
gtcacatagaggtacatatatagagctggtggcgtttgtcccatttcgtt
tccaacatgagcaagtcatgcgacggtgccaagacggagtggcctgagct
ggtcgggtgcacgatcaaggaggccaaagaaaagatcaaggcggaccggc
cggacctcaaagtcgtcattgtgccggtaggaagtattgtgacacaggag
atcgatttgaaccgcgtccgtgtctgggttgacaaggtggcgaaggttcc
caagattggctaagctagctgaataaatgcccatgcaagtctcaatatcg
tccagttaatcaaccgaataaataagcagggtaccttttggagaaacata
acatgagtgttgcgggtgtttcgcagagaatgtatggatgtgtgtgtgtg
tgttttgcggggaagtatggatgtgttatgtaatgttgttttgttcaagt
tgtaataagcatcggtaatattgtacgtccctgtttatatattgtctaat
aaatataatctactttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search