Query (optional)   in Class  

GrainGenes Sequence Report: Y09013

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y09013
Subsequence
Y09013_1.cds1771406
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC317724
NCBI UniGene
Ta.893
Data at Gramene
Gramene-Protein O04168
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcriptional activator'
Keyword
spa gene
transcriptional activator
Species
Triticum aestivum
Cultivar
Chinese spring
Tissue
seed
Data Source
genbankRelease 135, Apr 15 2003
Title
T.aestivum mRNA for transcriptional activator.
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Gene: SPA
EMBL Feature
feature_gene11647Location: 1..1647
DNA
ccacaacccatgggttagccatagccaaaacccgtggtgtgtcacccgcg
tcattgggcatctccgtcctctcttcgccggttcccacggggttaaaaag
tttaagccataccattcctcgcccaattttgttctaatcaatcacctttg
ccccagttccatttcggaaagcttccatggagcccgtgttcttctcactg
gaggaggcgatgcccgagcccgactctaacccctgccggacctcgtcgcc
gccgctggaggcacacatgctcgtcgcaggactcggaggagtgggcgccg
gcgaggtcgtcggcgggtgcgcgacgaacgagtgcgcgacagaatggtgc
ttccagaagttcgtggacgagccgtggctgctcaacgtccccaccgcgcc
agtggcgaaccccgaagcttcgacgctttaccctaatcccacggccgagg
ggagccgcaagaggccgtacgacgtccatgagatggtgggcccggaggag
gtcatccccacgccgcctgcggcgagcccggtggtggaccccgtggcgta
caacgcgatgctcagacggaagttggacgcgcatctcgccgccgtcgcca
tgttgaggaccactcggggaatttgcccacaaagctcccatgacaatgga
gcatcgcaaaattcagattccatccaaggctcagaaaaccacaccggaga
tgtcagtttgcatcaacttagctcttcctcattggagccatcaccatcag
atggtgatatggaaggggaggcacaaacaattggaactatgcatattagt
gcagagaaagcgaataagaggaaagaatctaacagggattcggcgagacg
ctcaaggagtagaaaagcagctcatgcgaaggaactagaggagcaggtct
cactattaagagtcgcaaataactctttgatgagacatcttgcagatgta
agtcacagatacgtcaatatctctattgacaatagggtactaaaggcaaa
tgttgaaaccctagaagcaaaggtaaagatggccgaggaaactatgaaga
gggttacatgcaccaacaatttcccccaagcaatgtctagcatatcatct
ctcgggattcctttcagtggctccccattgaacggtatctgtgataatcc
attgccaacccagaacacctcacttaactacctccctcccacaacaacaa
attttgatgtgaacaacaactacatccccgagccagctctggcgttccag
atccaggatcaaataccttcgctacatatgcaacctatgtcatgcttgga
tcatcacccgcagaggatgcacataggtattcctacatcagcacctactc
cgcaacgggaatctactacattggattcaactgaaatagtcaacatggtg
atgtagtaggaattttatgggagacctgagcaggaattacttttctcaaa
ttgttttcgttgttgttgttgttaaccgttgggggtatttagaatggttt
cttcaacttgttaagtggacatttcttagacttgtttaagaaatatatat
tgttgttgtttcagaataagaacctagacatagttggtctttgataacta
atacatatattgaaggttattggacaataaagtgatgtggttgagtc
BLAST
BLAST Search