Query (optional)   in Class  

GrainGenes Sequence Report: Y09217

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y09217
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Aegilops speltoides
Keyword
tandem repeats
variation
Species
Aegilops speltoides
Chromosome
12
Clone Library
pBluescript SK+
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
A.speltoides family of tandem repeat DNA.
Strain
ligustica
Remark
DB_xref: taxon:4573
[ Show all 8 ]
EMBL Feature
misc_binding8593Location: 85..93
[ Show all 6 ]
DNA
cgataacttgctcctctatggcacggccagaagaacttattgctatccaa
accatccccgtcaagcgccgttcacaacatttgccaaattatgtaccgat
atatgacctcatgttgagaatttggcctaaaaacggccatatgtgagtcg
BLAST
BLAST Search