Query (optional)   in Class  

GrainGenes Sequence Report: Y09233

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y09233
Subsequence
Y09233_1.cds321231
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
NCBI UniGene
Hv.42
Data at Gramene
Gramene-Protein Q96562
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Homoeriodictyol/eriodictyol chalcone synthase'
Keyword
Chalcone synthase
CHS2 gene
homoeriodictyol/eriodictyol chalcone synthase
Species
Hordeum vulgare
Hordeum vulgare subsp. vulgare
Cultivar
P-02, near-isogenic line of cv. Pallas
Clone Library
cDNA library from 10d old plants, 3 days after inoculation with virulent
Tissue
1st leaf
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
H.vulgare mRNA for homoeriodictyol/eriodictyol chalcone synthase.
Strain
vulgare
Probe
HVCHS2
BH72-08
Remark
DB_xref: taxon:112509
[ Show all 6 ]
EMBL Feature
polyA_site14251425Location: 1425
feature_source11493/organism="Hordeum vulgare" /cultivar="P-02, near-isogenic line of cv. Pallas" /tissue_type="1st leaf" /clone_lib="cDNA library from 10d old plants, 3 days after inoculation with virulent"
feature_gene11493Location: 1..1493
DNA
cgttgctgtcgggaagtcgctagtgctgctaatggctgcggtgaggttga
aggaagtgagaatggcacagcgggctgagggcctggcgacagtgctggcc
attggcaccgccgtgccggccaactgcgtgtaccaggcgacctacccaga
ctattacttcagagtcacgaagagcgagcacctcgcggacctcaaggaga
agttccagaggatgtgcgacaagtccatgatcagaaagaggcacatgcac
ctaaccgaggagatactaattaagaaccccaagatctgcgcgcacatgga
gacctcgcttgacgcgcgccatgccattgcgctcgtcgaggtcccgaagc
tggggcaaggagctgcggagaaggcaatcaaggagtggggccagccattg
tccaagatcacccacctcgtgttctgcacaacctctggcgtcgacatgcc
aggcgccgactaccagctgaccaagttgctcggcctctccccgacggtga
aacgcctgatgatgtaccagcaggggtgcttcggcggcgccacggttctt
cgccttgccaaggacatcgctgagaacaaccgcggcgctcgtgtgctggt
tgtctgctcggagataaccgccatggccttccgtggtccttgcaagtccc
atctcgactcgctggtcggccatgcactctttggcgatggcgcagctgct
gccatcatcggcgctgaccctgaccagctggacgagcagccagtgttcca
gctggtgtcagcgagccagaccatcctgccggagtcggagggagccatcg
acggccaccttacggaggcgggcctgaccatccaccttctcaaggacgtg
ccgggactcatctctgagaatatcgagcaagcattagaggacgcgtttga
gcctctgggcatccacaactggaactccatcttctggattgctcaccctg
gggggcctgccatccttgacagggtcgaggacagagttggccttgacaag
aagcgcatgcgcgcaagccgggaggttctgtcggagtacggaaacatgtc
cagcgcaagtgtactcttcgtccttgacgttatgcgtaagagctccgcca
aggatggcctcgccacaactggagaaggcaaggactggggtgtcctcttc
ggcttcggccctggcctcaccgtcgagacactcgtcctccacagcgtccc
cgtccccgtccccaccgccgctagtgcatgatcgacgcatgccatattta
gcttatttgggtcaagacaataaaataagcggcccacaaatatgaaccac
gtccgacaatacgagcacctggctgggggcgctcctgcctgttaaaccat
agatgtacgtacctcgtgatttgtgtctacagtatattgtaaacgttcac
ccatcaaagttgtattttcatccttaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search