Query (optional)   in Class  

GrainGenes Sequence Report: Y09291

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y09291
Subsequence
Y09291_1.cds11362
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277234
NCBI UniGene
Ta.55700
Data at Gramene
Gramene-Protein P93596
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Obtusifoliol 14-demehylase (cyp51 gene)'
Keyword
CYP51 gene
obtusifoliol 14-alpha-demethylase
Species
Triticum aestivum
Cultivar
Darius
Tissue
shoots
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
T.aestivum mRNA for obtusifoliol 14-alpha-demethylase (CYP51), clone w516, partial.
Strain
Darius
Clone
w516
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Gene: CYP51
EMBL Feature
feature_gene11655Location: 1..1655
DNA
cggccgccgccgacgatcccgggggcgcccgtcgtgggcgggctgctgcg
cttcctgcggggccccatcccgctcatccgggccgagtacgcccgcctcg
gccccgtcttcaccgtccccatcctcacccgccggatcaccttcctcatc
ggccccgacgtctcggcgcacttcttcaagagcaacgagtccgacatgag
ccagcaggaggtctaccgcttcaacgtccccaccttcggccccggggtcg
tcttcgacgtcgactaccaggtcaggcaggagcagttcaggttcttcacc
gaggcgctcagggccaacaagctccgcagctacgtcgaccagatggttgc
cgaggccgaggagtacttctcgaagtggggagaaagtggcactgtggatc
tgaagtatgaattggagcacctcatcatactgactgctagccgatgcttg
ttgggaagggaggtgcgagaaaagttgtttgatgatgtttctgctctctt
ccatgatcttgacaatgggatgctgccaatcagtgtcatctttccctacc
tcccaatccctgcacaccgccgccgtgaccaggcacgaacacgtttggcg
gagatcttcgccactatcatcaagtcccgcaaggcctctggacagtctga
ggaagacatgctgcaatgcttcattgattccaagtacaagaatggccgcc
agaccacagaaagtgaggtgactgggctacttatcgcagccctgtttgct
ggacagcacactagctcgatcacctcaacctggactggggcctacctgct
taagttccagcagtactttgcagaggctgttgaggagcagaaggaggtca
tgaagaggcatggtgacaagatcgatcatgacatcttggcagagatggat
gtcctctaccggtgcatcaaggaggcgctccggctccacccgccgctgat
catgctgcttcgccaatcacactctgacttcagcgtgaccacgagggaag
gcaaagagtttgatatccccaagggccacattgtcgcaacatctcctgcc
ttcgctaacaggctcccccatatattcaagaacccggactcgtatgaccc
tgaccggtttgcagctgggagggaggaggacaaggttgcgggtgccttct
cgtacatctcctttgggggtggcaggcacgggtgcctcggtgagcccttc
gcgtacctgcagatcaaggcaatatggacacacctgctgaggaactttga
gttcgagctggtctcaccattcccggagaacgactggaatgcgatggtcg
tcggcatcaagggtgaggtgatggtcaactacaagcggcggaagctcatc
gtcgacaactagagagtgggtggtcccatagggggtgtttgcttctgtat
ttgttccatttaagttttgttgtccgcacgccaacctgtagggtatctat
cttcaccattgtttagggtactgtgatttgcttccagtgattatttagac
gtgtagcatctgagtgttgtttctctctcctttcatctttgctgctgtcc
attctcttagacgggttcagacataaaatgtgaacagacaaccctatgta
aggaacacaacagctgtgactgagttcattcaaaatgcagttcttgcttt
tgctc
BLAST
BLAST Search