Query (optional)   in Class  

GrainGenes Sequence Report: Y09292

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y09292
Subsequence
Y09292_1.cds1939
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277234
NCBI UniGene
Ta.9296
Data at Gramene
Gramene-Protein P93596
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Obtusifoliol 14-alpha-demethylase (CYP51), clone w51, partial'
Keyword
CYP51 gene
obtusifoliol 14-alpha-demethylase
Species
Triticum aestivum
Cultivar
Darius
Tissue
shoots
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
T.aestivum mRNA for obtusifoliol 14-alpha-demethylase (CYP51), clone w51, partial.
Strain
Darius
Clone
w51
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Gene: CYP51
EMBL Feature
feature_gene11231Location: 1..1231
DNA
ctcatcatactgactgctagccgatgcttgggaagggaagtgcgagaaaa
attgtttgatgatgtttctgctctcttccatgatcttgacaatgggatgc
agccaatcagtgtcatctttccctacctcccaatccctgcacaccgtcgc
cgtgaccaggcacggacacgtttggcggagatctttgccacgatcatcaa
gtcccgcaaggcctctggacagtccgaggaagacatgctgcagtgcttca
ttgattccaagtacaagaatggccgccagaccacagaaagtgaggtgact
gggctacttattgcagccctgtttgctggacagcacactagctcgatcac
ctcaacctggactggggcctacctgcttaagttccagcagtactttgcag
aggctgttgaggagcagaaggaggtcatgaagaggcatggtgacaagatc
gatcacgacatattggcagagatggatgtcctctaccggtgcatcaagga
ggcgctccggctccacccgccgctgatcatgctgcttcgccaatcacact
ctgacttcagcgtgaccacgagggaaggcaaagagtttgatatccccaag
ggccacatcgtcgcaacatctcctgctttcgctaacaggctcccccatat
cttcaagaacccggactcgtatgaccctgaccggtttgcagctgggaggg
aggaggacaaggttgcgggtgccttctcgtacatctcctttgggggtggc
aggcacgggtgcctgggtgagcccttcgcgtacctgcagatcaaggcgat
atggacacacctcctgaggaactttgagtttgagctggtctcaccgttcc
cagagaacgactggaatgcgatggtcgtcggcatcaagggcgaggtgatg
gtcagctacaagcggcggaagcttgtcgtcgacaactagagagcgggtgg
tcccatagggggtgtttgcttctgtatttgttccatttaagttttttcta
ttcgcacgccaacctgtagggtatctatcttgccattgttttagggtact
ttgatttgcttccagtgattatttagacgtgtagcatctgagtgttgttt
ctctctcctttcatctttgctgctgtccattctcttagacgggttcagac
ataaaatgtgaacagacaaccctatgtaaggaacacaacaactgtgactg
agttcattcaaaatgcagttcttgctgcaaa
BLAST
BLAST Search