Query (optional)   in Class  

GrainGenes Sequence Report: Y09602

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y09602
Subsequence
Y09602_1.cds22855244
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC162256
Data at Gramene
Gramene-Protein P08818
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Keyword
serine carboxypeptidase
Species
Hordeum vulgare subsp. vulgare
Cultivar
Igri
Tissue
etiolated leaves
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
H.vulgare gene encoding serine carboxypeptidase II, CP-MII.
Strain
vulgare
Igri
Gene Product
carboxypeptidase chain A
carboxypeptidase chain B
Remark
DB_xref: taxon:112509
[ Show all 11 ]
EMBL Feature
TATA_signal19141926Location: 1914..1926
[ Show all 17 ]
DNA
aacaaagccattgttgtttctatatccactttaaaatatagaccttgatg
cactgatgaggttttgcgttatataccaaaaagcatggtccctataccag
tagtatcacaatggataattttgtaacccaactgtccaatttactttagt
ggggtaaccattgcatgaaacaattcgttggaacttggaaggcgaacctt
actgaattgcctgagtatgcgcatggaaattattttatgttggaagttat
atactgtgatatggcaaattgcacctgtttatacggtatccaagggcatg
tgcacatgttaatatgttttctttatgatactcagcaaggcaaacgtgaa
ggcaaaatctccatcaaagaagaaacagaaaggaaaaaccatcaatgagc
gtgacatgtatcagaataactatttccatgccagcgaagcttttttttca
atccttctggacaaggacaacagctcgacaattctctcgctgaagaaagc
aggtcccgagatcactgaactgttgacacaatgctctattggtattgctg
gaactggtctggctgttcttctgtcggtcgtgtgcaagatcgccattggc
gggaggactccttttgccgctactcggctgctgcacacaggcgttgggtt
tgggctcttctggctctcccacgcggtaaatggactgcggaacacaatca
ccaccgtattcagaggcccggtcgacgcaaagttggaggatgaggttgct
gtgaagatacaaagaagcatgaacgatattctcttcagggccgtaactct
cctggcaatcactgctttgaggtttgcataagctgttcctacactgctgt
aacttgacgcacctcgatgtatgattacccttttggttcaggagtgcggt
ttctgtaggactaaagtgccaaataccttcatgattcatgatggcctcat
agaaaatgtgagacgttgtaaattgtacagaattttgctggcagctcggt
gtatatggaagatagattttgcctgttctgaacgttaattaagctaatgg
tcaatgtactttgtatttcttgcagacagatagctgcttcacccattttc
ctgttatattttttcttggtaacatagcaatattgggataggtctgttga
catagcaatcttgggatagtagattcgaaggtttcaactgctaaaagttt
tgtgcagtactgcaagttaatgaagttaccatttaacaaatcattgccta
acactattttcagctcatgctgaccacatcaacatgtcttcttttttgtt
cataggagcatttagatcactaaagcagtgatctaaatgcgcttatattg
tttacgaagggagtactatttactttctgaatgttgtgacattcctcaat
ttaattctttgttccataaaatttaagtatggaacatttctccattaaaa
agtgctactccctcctatccaaattaagcgctgtggttttagttcaaagt
agtttttgattttatatacgtttccttcatcatacataattcatctaaga
tcaatcagtctttaaattcgcatagcaacgcggggggaaataacgtgcca
tcatgccaaggattagaaacgaacgattggccttttatggttgctttcag
gcaatcgatacagtttctcatcttccatgtccttttctctggacatgtct
tgtgaacaaaataccaacgtcacattcctactcttaatttattttttctg
tcgtagttgcgctgatactctttgttcactcacaatgcatatgataattt
tttacaatcctttcagccacaagattagaaacgaaatcaatcacaagctg
gctagaattcaatcttttaaatccccgtagcgacgtgcagggaaatcacc
agtatttaacatatttatatataaaatctgtgcccttaaatggataaaat
caagccagtgattagtaacgaaatcaatcacaagctggctagaattcgct
tccaggcaacccatgcagtttcttatcctccatgtccctttcctctgacc
gtccggtaaccgaattcacaatgtcacaatcctccccttaatttcttcct
ccctcacagccacgctagctcaataaactgaaatcaaaagatagaagaaa
aaagaagataacttcacgaaagcgtgcggtccaaaccaaacaacgacacc
catcagaacctctatttattctcaccgtgttcccgcttctctgcaagcaa
ctgtaccgactgcaacacagttccttcagtaagcatgaggactacgaccc
gccgtctccccccagctccggcggcggcggcggtgctcctggcggcgttg
acgtgcctcctcctccggccagccgccgtcgccgcggcgggcggccatgc
cgcggaccgcatagtccggctgccggggcagccggaggtggacttcgaca
tgtactccgggtacatcacggtggacgaggccgccggacggtcgctcttc
tacctgctgcaggaggcgcccgaggaggcccagccggcgccgctcgtgct
gtggctcaacggcggccccggctgctcctccgtcgcctacggcgcgtcgg
aggagctcggcgcgttccgcgtcatgccccgcggcgccggcctcgtcctc
aacgagtaccgctggaacaaaggtgggtacccggtcgctattgcttgctt
gatcgacggtcggtctgtcgagcttctaatggtggagaatgattgacttt
gctgtttgcagtggccaacgtgctgttcctggattcgccggccggcgtgg
ggttctcctacaccaacaccagctccgacatctacacctccggcgacaac
aggacggcgcacgactcgtacgccttcctggcggcatggttcgagaggtt
cccgcactacaagtaccgcgaattctacgtcgccggcgagagctacgccg
ggcactacgtcccggagctgtcgcagctggtccaccggagcggcaacccc
gtcatcaacctcaagggcttcatggtcggcaacggcctcatcgacgacta
ccacgactacgtcggcaccttcgagttctggtggaaccacgggatcgtct
ccgacgacacctaccgccgcctcaaggacgcctgcctccacgactccttc
atccacccctcgccggcgtgcgacgccgcgacggacgtcgccacggcgga
gcagggcaacatcgacatgtacagcctctacacccccgtctgcaacatct
cgtcgtcgtcgtcgtcgtcgtccttgagccggcggcggaccagagggcgc
tacgtgagcatcctgggcacagactccctgcgtcgttgtccattaacttt
ttgaggtgaaaaatgatgtaacgccgtgcgtgtgctgcagccatggctga
ccgggtcgtacgacccgtgcacggagaggtactcgacggcgtactacaac
cggcgggacgtgcagacggccctccacgccaacgtcaccggcgccatgaa
ctacacgtgggcgacctgcagcgacaccattaatacccactggcatgatg
ctccgaggtccatgcttcccatctacagggagctgattgcagctggccta
aggatttgggtcttcaggtcagatcatgattccttagttgagcttaacaa
tgcaatccagcatttcttaactgaattatactattacgtactgtataata
ctacacgtttgcttcggtactctcttataaaatgttccgctagggtaacc
attttttggacgaatttgccgatatatttcatcaggaatctatcggtttg
catcccttgtcattccgtatgcaccagtttgatcgcaatgcatctgaacc
aatgattagatttttcttgaatttcaggacgttttgttctcttctatttt
agggcacctgctctgcatattagctttgaccaagttcatggaaaaataat
atgaatttttacaacaacagatatatatgttgtaaaaacatgttttatga
tgattccagtggtattgatttggtattgtggatgttgacatattattttt
ttcatataaatttgatattgataataacacatgctgtggtaaaacctcct
tttcagaagaacacccacatccttttcgaaaagaaaacagtactaaatga
caataggtacaccgatgtacatcaccgacgactgacgactccgttgtttg
gttggttgtatgactctttggtttctgccatatgtcgttatctataaagt
cgggcataagcttttatcagacatcatcagccagttcacaagagaagctg
cagataatacgctgctttgactgaatgaattcactcattcggaagccacc
catccgaatcaacaatcatcgatgaaccatcgacatttatgcataatatt
cttctgttgacccgtcagcccaacattaggatccacaactggaccccgga
cgtctcttttcttcttgtgctcagctctcaagtttgcaacttgtcgggtt
gctgtcatgcaacaagatgatgcccatgggatatgaaggcagttttcctt
tagaaagatagagggagatgagcgttgctgtcgatccgtcagccgcttcc
cgccgcacaattcagttagcgttaacacaatgttgttgtgtttatttcgc
agcggcgacacggatgcggtagtccccttgacagcaacaagatactccat
cggcgctctgggtcttgcaactactaccagttggtacccttggtatgacg
acctgcaggaggtcagcatcatcccactcgactcttttgcaaagtaatat
ccatagaattattgagatgctcttgtgggtatacaaatagactacattcc
cccctttttttaaacactacattcgcttatctaccttctccatatagtac
atttgtattattttcttagattgggtaatttcattcacatggcccaatgg
agattacactgcaacaatgcaacatgccagcaaaaatttagatgtcacat
ttagtttgtgttaaagtagctagtactccatgttacacacataatttact
agtgcttgtgtgatggatttcttgactaggtcggcggctggagccaggtg
tacaagggccttacgctggtgtccgtcagaggtgcgggccatgaggttcc
tctgcaccgtccgcggcaagcgctcatactgtttcagcaattcctgcagg
gcaagcccatgccaggccgtaccacaaatgtgacggtggcttaacaacaa
acaaagggatggaagtcaaatagtagtaatctcgatgtgttaaaaacgaa
agtgatcatcaataaagcaatagatgcttcttaactacttttcctggata
gctagtatatgcgcataatgcatgattcatccagaatatatggacagacg
cactaacgcaaagcgcaaaaaaacatagacgaaatactttacggagggca
agaaacgaacaacgaattgcatttgatattccaataagaccaatgtctct
acaagcaacattaagaaccaacatcaaaacagaatgacaggagttgcact
caccagcaacctatgataatggtgtaatcttaagaagttgcacgctcgat
ctatcatatgagatcatgtaaggaagaaaacttgacggagctgcgctgct
ggtcatgttgacaacagacaacttggcatcagcagctgccctggcaaagc
atttgaaagtgtccgcattccgaataactgtggcgatataggccacagga
cctccagtttcgctggtgccagatacttcatcaatttctccattggttgc
ttcattgacaatttcacgtcgtccatcgtctcctctaagtagcatacaaa
gtactcgtaccaggtggggcacgcaagacgggttgtatataatgtctgca
ccaagactggcaagagacagagggtaaatgatatgcagaagcatgaacag
caggaacatgtgatgttctccagttcggaattaggctactcattctctaa
cagacacaatagtaaataaggttcttagagtagtgtttaaatttgaaatc
agttcagaaactaacggtttaacaaaaggactgaaaaagaaggatataac
aatacaaaaagaatatacaatactcacactatgtctctctggtagtctct
taaatcgctttcacacgcttcttcccaggaaagatatttgcactcgacct
acatgccaggaacataagaaagatt
BLAST
BLAST Search