Query (optional)   in Class  

GrainGenes Sequence Report: Y09603

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y09603
Subsequence
Y09603_1.cds861585
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC153961
NCBI UniGene
Hv.12403
Data at Gramene
Gramene-Protein P07519
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Carboxypeptidase I precursor'
Keyword
serine carboxypeptidase
Species
Hordeum vulgare subsp. vulgare
Cultivar
Himalaya
Tissue
aleurone
Developmental Stage
GA-treated
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
H.vulgare mRNA for serine carboxypeptidase I, CP-MI.
Strain
vulgare
Himalaya
Gene Product
carboxypeptidase chain A
carboxypeptidase chain B
Remark
DB_xref: taxon:112509
[ Show all 9 ]
EMBL Feature
mat_peptide176973Location: 176..973
[ Show all 7 ]
DNA
cggcgactcgtcgctagcaaccacagtaccagtaccaccaccaccaccgt
cttgccgaaggtcgaagcgaagtctcgtacgtacgatggcccggtgccgc
cgccgctccggatgcacagccggcgcggccctgctcctcctgctcgccct
cgccctctccggcggcggcggcgcggcaccgcagggcgcggaggtgacgg
ggctcccggggttcgacggcgcgctgccgtcgaagcactacgccgggtac
gtgacggtggacgaggggcacgggcgcaacctgttctactacgtggtgga
gtcggagcgcgacccgggcaaggaccccgtcgtgctctggctcaacggcg
gccccggctgctccagcttcgacggcttcgtctacgagcacgggccattc
aatttcgagtcgggcgggtcagttaaaagcctgccaaagctccatctcaa
cccttatgcctggtccaaggtgtctaccatgatatacctggactcccctg
ctggcgtggggctgtcatactcgaagaatgtttcagattatgaaacggga
gacctcaagaccgcgacggattcgcatactttccttctcaagtggttcca
attgtaccctgagttcctgagcaacccgttctacatagctggggagtcgt
atgctggggtttatgtccctactctttcgcacgaagtcgtcaaagggata
caaggaggagctaagccaactataaacttcaagggctacatggtcgggaa
tggcgtctgcgacactatctttgatggcaatgctcttgtgccatttgcac
atggaatgggtctaatatcagatgaaatataccagcaagctagtacgtcg
tgccacggaaattactggaatgccactgacggtaaatgtgataccgctat
atcgaaaatcgaatcgttgatcagcggacttaacatttatgacattcttg
agccatgctaccacagcagaagcatcaaagaagtgaacctgcagaatagc
aaattgcctcaaagtttcaaagatcttggtacaactaacaagccatttcc
cgtaagaacgagaatgctggggcgtgcttggcctttgagagctcctgtaa
aagccggacgtgttccgtcatggcaggaagttgccagtggtgttccatgc
atgagcgacgaagttgcaacagcatggcttgacaacgctgccgtcagatc
tgcaatccatgcccaatcagtaagtgcaattgggccatggctcttatgca
cagataaattgtatttcgttcatgatgctggtagtatgatcgcttatcac
aagaacctcacaagccagggttatcgtgccatcatattcagtggcgacca
tgacatgtgtgtgccattcaccgggagtgaagcatggacaaaatctttgg
ggtatggagttgttgactcgtggcggccatggatcacaaacggacaagtt
tctgggtacaccgaaggatatgaacatggtctcacttttgctactattaa
gggtgctggacacaccgttcctgagtacaaaccacaggaagcatttgctt
tctacagccgttggctcgctggttcaaagttgtgaagcttgtgcccagct
acaaataatggggaatatacttctgcatacagtcaagaatgaacaaatag
agacttgaagaagaaagagatggcctacacgccatatagatagtcacata
cccaaatatcaaaaatagcaattggaacactgtgcgttgtattctttcat
caaatatatttggtcgatgcagctttggtgttattgctttcatgctttgt
ccactatgcgatcatgacttctgaatttcagttgatatggagagtatttc
gtaccctcaaaaaaaaaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search