Query (optional)   in Class  

GrainGenes Sequence Report: Y09604

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y09604
Subsequence
Y09604_1.cds221548
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC183542
NCBI UniGene
Hv.139
Data at Gramene
Gramene-Protein P21529
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Serine carboxypeptidase III, CP-MIII'
Keyword
serine carboxypeptidase III
Species
Hordeum vulgare subsp. vulgare
Cultivar
Himalaya
Tissue
aleurone
Developmental Stage
GA-treated
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
H.vulgare mRNA for serine carboxypeptidase III, CP-MIII.
Strain
vulgare
Himalaya
Gene Product
unnamed
Remark
DB_xref: taxon:112509
[ Show all 7 ]
EMBL Feature
mat_peptide2621494Location: 262..1494
misc_feature79261N-terminal propeptideLocation: 79..261
sig_peptide2278Location: 22..78
feature_gene11765Location: 1..1765
DNA
tcccccaccaccgcgcaaacaatggtgacgaccccgcgcctcgtctcgct
gctcctcctgctcgcgctctgcgccgcggcggccggcgcgctccggctgc
ccccggacgccagcttccccggcgcgcaggcggagcggctcatccgcgcg
ctcaacctgctccccaaggactcctcctcctcctccggccgccacggtgc
cagagttggtgagggaaatgaggacgtcgcgcccgggcagctgctggagc
gtcgggtcacgctccccggcctccccgagggggtcgccgacctcggacac
cacgccggttattaccgtctccccaacacccacgacgccaggatgttcta
cttcttcttcgagtcgcggggcaagaaggaggaccccgtggtgatctggc
tcaccggcggcccggggtgcagcagcgagctcgccgtcttctacgagaac
gggcccttcaccatcgccaacaacatgtcgctcgtctggaacaagttcgg
gtgggacaagatctccaacatcatatttgttgaccaacctaccgggactg
ggttcagctacagctccgacgatcgcgatacccgtcacgacgagacaggg
gtcagcaatgacctgtatgactttctccaggtcttcttcaagaagcaccc
ggaattcataaagaacgacttctttataactggtgaatcctatgctgggc
actacattccagcatttgcaagccgagttcaccaaggaaacaagaaaaat
gagggcactcacataaacctgaaaggatttgcgattggtaatggcctcac
agatccagcaatccaatacaaagcctatacagactacgcattggaaatga
atcttattcagaaagctgactatgaaaggatcaacaaattcatcccacca
tgtgaatttgcaatcaaactctgtggtacaaatgggaaagcatcttgcat
ggcagcatatatggtctgcaataccatcttcaactccatcatgaaacttg
tggggacaaagaattattacgacgttaggaaggagtgcgaagggaaactc
tgctacgacttctcaaacttggagaaattctttggcgacaaagcagtcag
acaggcgattggagtaggtgatattgaatttgtctcatgcagcacttcag
tttaccaagcaatgctcacagactggatgaggaacttggaagtcggcatc
ccagctctacttgaggatgggattaatgtgctcatatatgctggggaata
tgaccttatatgcaattggctcggaaactcaaggtgggtccactccatgg
aatggtctggtcagaaagactttgccaaaacggctgaatcatcgttttta
gtagacgatgcccaagctggagttctgaagagccacggggcactcagttt
cctcaaggttcacaatgctggccacatggttccgatggaccagccgaagg
ccgcccttgaaatgctgaggagattcacccaggggaaactcaaggaggcg
gttcctgaagaagagtcatcgacgacctcgttttacgccgcgatgtgatt
gtcaacaccgaccacaaaaggagaagaaacttgctaggtagcctgcacgc
ttcgcccttgcggtctcaaggagtgcctgctgtagcttcctgttttccat
gtatctttttctccgatgtttcaactggatatgtatagtccctaataaca
agaacgttggccccgaaatgtaactgcccgatgtatgcttgatgaagtga
tgatgatgaaggatg
BLAST
BLAST Search