Query (optional)   in Class  

GrainGenes Sequence Report: Y09741

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y09741
Subsequence
Y09741_1.cds841427
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC156567
NCBI UniGene
Hv.735
Data at Gramene
Gramene-Protein P93176
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'CDNA clone: FLbaf149j12, mRNA sequence'
Keyword
beta-tubulin 1
btub1 gene
Species
Hordeum vulgare subsp. vulgare
Cultivar
Igri
Clone Library
HV35-3_P1S1
Tissue
leaf
Developmental Stage
seedling
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 150, Oct 8 2005
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare mRNA for beta-tubulin 1.
Strain
vulgare
Remark
DB_xref: taxon:112509
[ Show all 6 ]
EMBL Feature
misc_feature1707sequence read on one strand onlyLocation: join(1..707,983..1646)
feature_gene11646Location: 1..1646
DNA
accacaccccctcctactccccccgctctccctctcgccgccgactgttc
tcgttgcgcgaaccatctcatacctcggcgaagatgagggagatcctgca
catccagggtgggcaatgtggcaaccagatcggtgccaagttctgggagg
tggtgtgtgatgagcatggcattgacccaactgggcgctacaccggtacc
tctgacctgcagttggagcgtgtcaatgtctactacaatgaggcctcctg
tggtcgctttgtgccccgtgcagttcttatggaccttgagccgggtacca
tggacagtgtccgcactgggccttatgggcagatcttccgccctgacaac
tttgtctttgggcaatctggtgctggtaacaactgggccaagggccacta
caccgagggtgctgagcttatcgattctgttttggatgttgtgaggaagg
aggctgagaactgtgactgtctgcaaggattccaagtatgccactccctt
ggtggtggtactggatctggcatgggtaccctgttgatatctaaaatcag
ggaggagtaccctgaccgcatgatgctgacgttctcagtgttcccctcac
caaaagtatctgacactgtggttgagccatacaatgcaactctctcagtc
catcagttggttgagaatgctgatgagtgcatggttcttgacaacgaggc
tctctatgacatctgtttcaggactcttaagctgaccacacctagctttg
gggacttgaaccatctaatctctgctaccatgagtggagtcacatgctgc
ctgaggttccctggtcagctgaattccgacctccggaagctggcagtgaa
ccttatccccttccctcgcctccacttcttcatggtgggctttgctccat
tgacatcccgtgggtctcagcagtaccgtgccctcacggtcccagaactc
acccagcaaatgtgggatgccaagaacatgatgtgcgccgccgatcctcg
ccatggccgttacctcaccgcctctgccatgttccgtggtaagatgagca
caaaggaggttgatgagcagatgatcaacgtccagaacaagaactcgtcc
tacttcgtggagtggatccccaacaacgtgaagtccagcgtctgtgacat
cccgccgacagggctctcgatggcgtccaccttcgtcggcaactcgacct
ccatccaggagatgttccggagggtgagcgagcagttcactgccatgttc
aggaggaaggctttcttgcattggtacactggcgaaggcatggacgagat
ggagttcaccgaggccgagagcaacatgaacgacctcgtctcagagtacc
agcagtaccaggatgccactgccgacgaggagggcgagtacgaggatgag
gatcaggaggccgaggacgacatgtaaggagggggaggtctgtgtggtgc
tttgctgggtgggggttctaggggcagagtttgatctgtttggtgctttg
ttatgaatctgtttatcatcgcaactaccgcttgtacgccaccgccattc
ttcctgcctttcctaagctttgtattttccatgttatggcaccttctggg
tattgtatcacttgatgccgtaaaaaaaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search