Query (optional)   in Class  

GrainGenes Sequence Report: Y09748

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Y09748
Subsequence
Y09748_1.cds1215
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC191643
NCBI UniGene
Hv.8695
Data at Gramene
Gramene-Protein O04224
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Potassium channel'
Keyword
potassium channel
Species
Hordeum vulgare
Tissue
leaf
Developmental Stage
adult
Data Source
genbankRelease 135, Apr 15 2003
Title
H.vulgare mRNA for potassium channel, partial.
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA'; cell_type = 'epidermal cells';
DNA
aagacgtggataggggcagcaataccaaactacagatcagagagtctatg
ggttcgatacgtgacatcaatttattggtccattacaacactcacaacaa
ctggttatggcgatttacatgcggagaatccaagagaaatgtcattttgc
atatgtttcatgctatttaacctgggattgacagcatacctcattggcaa
catgaccaacctcgt
BLAST
BLAST Search