Query (optional)   in Class  

GrainGenes Sequence Report: Z11443

Sequence
Z11443
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Secale montanum
Keyword
5S DNA
Species
Secale montanum
Data Source
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
Secale montanum Guss. 5S DNA.
Remark
DB_xref: taxon:4551
Feature: source: mol_type = 'genomic DNA';
DNA
tttttaataattttttgcgtctcgtgacaggtatatacgcacgtgcaaga
tatatattgaccccgtttatttttcttcttctgattttccacgtttgcga
tacgttttaggccggtgcttattattcacgcgtccagcggcagtgttggg
cacggcaatcacgtttcgaaagtggtcgaaaccgtagtaaatacgcgttg
ctgcggcggagagggaggtgtaataaacgtggtaaagtcgcgtccgatgt
agagggagagagtggccgaaataatgtagaatcgtcctctagcgggcctg
ggaggggcaagcatcaggagggaagacggggataacatgtcggatgcgat
cataccagcactaaagcaccggatcccatcagaactccgaagttaagcgt
gcttgggcgagagtagtactaggatgggtgacctcctgggaagtcctcgt
gttgcactccc
BLAST
BLAST Search