Query (optional)   in Class  

GrainGenes Sequence Report: Z11430

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Z11430
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Thinopyrum junceum
Keyword
5S DNA
Species
Thinopyrum junceum
Data Source
genbankRelease 135, Apr 15 2003
Title
Elytrigia juncea (L.) Nevski 5S DNA.
Remark
DB_xref: taxon:4603
Feature: source: mol_type = 'genomic DNA';
DNA
ttttttaatttttttgtgccgcgtgcaaaacaaaacgcacgcgcgcggca
tatatttaccacgtttcatttattttccacgtttgcggtaagttttagct
cgctgctcactattcacgcgtctagcggcggcgttgtgcgcggcaggcgc
gctctgaaaggggtcgaaaccgtggtaaataggcgctggtgcggttgagg
gggaggggtggaaaccgtggtaaagtcgtctccgtagttgagcgggagcg
gccaaagcaatgtacaatcgtctttgtagtggagctgggaggggcaagca
taagggacgaagacgggggtaacatgtcggatgcgatcataccagcacta
aagcaccggatcccatcagaactccgaagttaagcgtgattgggcgagag
tagtactaggatgggtgacctcctgggaagtcctcgtgttgcattccc
BLAST
BLAST Search