Query (optional)   in Class  

GrainGenes Sequence Report: Z11434

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Z11434
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Hordeum bulbosum
Keyword
5S DNA
Species
Hordeum bulbosum
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum bulbosum L. 5S DNA.
Remark
DB_xref: taxon:4516
Feature: source: mol_type = 'genomic DNA';
DNA
ttttgaatatatttttgcgccacgtggcagcgaatgacgcacgtgagtct
atatatgaagcccatttcattatttttgacattttgtgaagtgttttagc
tcacggctcattgttcaggcgtatatgtgcggcaagggcgttcggaaagt
ggtcggggacgtgttagcgctcgtgttggtcgaggtagaggggtggcgcg
aaatctgtggtaacctcgtgtccgttgttgagcgggagggtgagtagtgt
ggtgcggtatccattactaggcgaatggtggtgagaatgcacggcccgtc
tttttagtgaacgtgggagggactgcataaggaaacaaatagttatgaag
atgtcggatgcgatcataccagcactaaagcaccggatcccatcagaact
ccgaagttaagcgtgcttgggcgagagtagtactaggatgggtgaccttc
tgggaagtcctcgtgttgcattcct
BLAST
BLAST Search