Query (optional)   in Class  

GrainGenes Sequence Report: Z11447

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Z11447
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Secale vavilovii
Keyword
5S DNA
Species
Secale vavilovii
Data Source
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
Secale vavilovii Grossh. 5S DNA.
Remark
DB_xref: taxon:4553
Feature: source: mol_type = 'genomic DNA';
DNA
tttttaattattttttgcgtctcgtgacaagtataacgcacgtgcaagat
atatattgaccacgtttattttcttcttctgattttccacgtttgcgata
cgttttatgccggtgcttattattcacgcgtccatcggcgacgttgggca
cggcgatcacgtttcgaaagtggtcgaaaccgtggtaaagacgcgttgct
gcggcggagagggaggtgtgataaacgcggtaaagtcgtgtccgtaggta
gagggagagaatggccgaaataatgtagaatcgtcctcgtagcgggtccg
ggagaggcaagcataaggagggaagacggggataacatgtcggatgcgat
cataccagcactaaagcaccggatcccatcagaactccgaagttaagcgt
tcttgggcgagagtagtactaggatgggtgacctcctgggaagtcctcgt
gttgcattccc
BLAST
BLAST Search