Query (optional)   in Class  

GrainGenes Sequence Report: Z11457

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Z11457
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Aegilops comosa
Keyword
5S DNA
Species
Aegilops comosa
Data Source
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
Aegilops comosa Sibth. et Smith 5S DNA.
Remark
DB_xref: taxon:4485
Feature: source: mol_type = 'genomic DNA';
DNA
tttttaattttttttgcgccgcgtgcaaaacaaaacgcacgtgcgcgaca
tatatatgtttagcacgttttattattttgcatgtttgcggtaagtttta
gctcgctgctcattattcacgcgtctagcggcggcaagcgtgttctgaat
gttaataggcactggtgcggttgaaccgtggaaaactcgtctccgtagta
gagcgggagcggccagaggaatgtgcaatcgtgtgtgtggtggagctggg
aggggcaagcataagggacgaagacgggggtaacatgtcggatgcgatca
taccagcactaaagcaccggatcccatcagaactccgaagttaagcgtgc
ttgggcgagagtagtactaggatgggtgacctcctgggaagtcctcgtgt
tgcattccc
BLAST
BLAST Search