STS primers used for PCR-mapping of translocation breakpoints

1) Product lengths with the symbol ~ were measured by electrophoresis, and the remaining were calculated from their sequences.
2) Capitals AJ indicate accession nos. of the EMBL/Gen-Bank/DDBJ nucleotide sequence databases. Capitals GG refer to the Triticeae database GrainGenes.

This list was generously provided by Gottfried Kuenzel, March 2000.

Reference
Kuenzel G, Korzun L, and Meister A (2000) Cytologically Integrated Physical Restriction Fragment Length Polymorphism maps for the Barley Genome Based on Translocation Breakpoints. Genetics 154: 397-412.

RFLP clone

STS primers

5------------------------------------------------3

Observed fragment (bp)1)

Annealing

temperature (C)

Reference for clone sequence2)

         

ABC152

AGTCGGCGCCGACCACCGGCGG

~300

58-60

GG/ABC152-5

 

AGTCGGCGCCGACCACCGGCGG

   

GG/ABC152-3

ABC153

GGTTTGAGGACATGGTTGTTTC

~330

52-55

GG/ABC153-5

 

GCCTCTGCCGCTGGAACTAC

   

GG/ABC153-3

ABC0156

TTACGGGATCAAAGCTGAGGC

197

58-60

GG/ABC156-5

 

GACAAGCAACACCAACCAAGC

   

GG/ABC156-5

ABC0163

GACACTGAATACGAGGGGAA

252

55-58

GG/ABC163-5

 

TGGCAGCGCTGTTGTAGGTT

   

GG/ABC163-5

ABC0164

CAAGAGCACAGGATGGCGACCGTCC

~1000

52-55

GG/ABC164-5

 

GAGGCAGCCCTGATGTAGTACCAGT

   

GG/ABC164-5

ABC0167

CAGCCCATGAGCTAGTGTTCC

202

52-55

GG/ABC167-5

 

TGGATGATGAAATTCCAGAGG

   

GG/ABC167-5

ABC0168

CCCGGTAACTACTTACACCG

223

55-58

GG/ABC168-5

 

CGTGGAGCTGGTGTGCGAGA

   

GG/ABC168-5

ABC0175

CAGTTTACAAGTGCAGAGGT

270

55-58

GG/ABC175-5

 

GAACAGAAGCAGAAGATCGA

   

GG/ABC175-5

ABC0302

CTGGTGCTTTCGATGCTGT

~1100

58-60

GG/ABC302-5

 

CTGAGTCTTCGCCATGCATA

   

GG/ABC302-3

ABC0309

GAGATACCACTGGGATTCTA

~600

55-58

GG/ABC309-5

 

CCCGGTTCAAAAAAGAAGAT

   

GG/ABC309-3

ABC0310

CTTCCCTCTCCTTCAAAGGCC

~1500

55-58

GG/ABC310-5

 

CCCAGTATCACCACAAACAGG

   

GG/ABC310-3

ABC0455

AAGGTTGATGGAAGCCAGTTG

~800

58-60

GG/ABC455-5

 

CTAGTAGGGCCGATAACGCC

   

GG/ABC455-3

ABG0001

CGTTGTTGATTCAGCTGGTT

378

55-58

GG/ABG1-5

 

GGCTTG CACATACTATTACA

   

GG/ABG1-5

ABG0003

AGTCCACTGATCCCGTGTCACG

~600

55-58

GG/ABG3-5

 

CCAACAGCATGATGCAGGCC

   

GG/ABG3-3

ABG0004

CTGCCACAAGGAATTTCCGG

317

55-58

GG/ABG4-5

 

AGCACCAAAGCACCTGAACCC

   

GG/ABG4-5

ABG0020

GGCAACCGCAAGAAAGAAAG

254

58-60

GG/ABG20-3

 

CCTCTCATGTCAGAGCATTT

   

GG/ABG20-3

ABG0058

CTTGATTATTAGGCCCGACGG

1022

58-60

GG/ABG58-5

 

CGCAAAGAACTGGAGGAACG

   

GG/ABG58-5

ABG0358

ATTCCAGAACCTCCTCGAC

150

50-52

GG/ABG358-5

 

AAGCCACATCAACATAATGC

   

GG/ABG358-5

ABG0377

CAGAGTTGTTAGGCCTGGAA

229

60-62

GG/ABG377-5

 

GACTCTTGGCCCTGCTCCAT

   

GG/ABG377-5

ABG0380

AAGCCCAAACAACTAGAAAGG

477

55-58

GG/ABG380-5

 

GCTGTCAACAGGAAGAAACCC

   

GG/ABG380-5

ABG0387

GCACTGGCATAGTCTCACAA

198

60-62

GG/ABG387-5

 

CGATGCTGGTTCGGTCATAC

   

GG/ABG387-5

ABG0388

GCACTGGCATAGTCTCACAA

303

55-58

GG/ABG388-5

 

CGATGCTGGTTCGGTCATAC

   

GG/ABG388-5

ABG0390

TGTTCCCAGCATTTGAACAG

357

55-58

GG/ABG390-5

 

CGGCAATCCTAATTTTTGGA

   

GG/ABG390-5

ABG0391

GCAAGTGCACTGCTGTACAA

~800

52-55

GG/ABG391-5

 

TGTTCTCGTACCATGACTTC

   

GG/ABG391-3

ABG0453

GCTATTGACAAGCAATGCC

~1000

58-60

GG/ABG453-5

 

GGTGACGTAGCACGCACTAA

   

GG/ABG453-3

ABG0458

GAGAGCCGATGACGGTATGT

248

55-58

GG/ABG458-5

 

CTTGGACACATGCCATATCC

   

GG/ABG458-5

ABG0460

CAGCGATTACAAGCGTGTAA

380

58-60

GG/ABG460-3

 

GGGACGTTCAAATTAACTTG

   

GG/ABG460-3

ABG0461

AGTTCAATGTTCACCACAGC

283

58-60

GG/ABG461-5

 

CAATGTACCGGACTATTTGG

   

GG/ABG461-5

ABG462

GCTAACGGTGAGCAGCCCGT

~600

60-62

GG/ABG462-5

 

GATAAGCCTGCACCCGTGCT

   

GG/ABG462-3

ABG0466

GGAGGGAAGCGGCTGATAAT

~250

55-58

GG/ABG466-5

 

CGTTGCAAATGGACGTGCCA

   

GG/ABG466-5

ABG0472

CCGCGTACGCGAATCTGAGT

~900

52-55

GG/ABG472-5

 

GCCCAGCTAGGTCGACAATA

   

GG/ABG472-3

ABG0476

CACATGCAAATGCAGTGGG

~900

58-60

GG/ABG476-5

 

TGGTTCAGAGTCCGGTTCC

   

GG/ABG476-3

ABG0497

GGATGAGGAGATACATGGAGC

~500

58-60

GG/ABG497-3

 

CATTTGGTGGTCAACAAGGC

   

GG/ABG497-3

ABG0500

ATTAATCCGACCGTCACTGC

189

58-60

GG/ABG500-5

 

ACGAACTCCTCGCTGCC

   

GG/ABG500-5

ABG0654

CGGTGTTGACGATCACATCG

156

55-58

GG/L44082

 

CAAGGTTCACAATGCTGGCC

   

GG/L44082

BCD0263

CCGTTACCTGCACAAGTTGC

~500

58-60

GG/BCD263-5

 

ACATTTCGGTGGTGGTCTCC

   

GG/BCD263-5

BG0123

CTGTGATTGACATGCCATTGC

310

52-55

GG/BG123

 

TCGTTTACATCCCTCATTAGG

   

GG/BG123

cMWG0647

GAAGTTGAGATGCCATGCCA

241

52-55

AJ234402

 

CCTCGACGGCCAAGTGTTTT

   

AJ234402

cMWG0649

CAACACTCCGTCAACCAGCAACCTC

441

55-58

AJ234403

 

GCCTGCGTTGTTGAATGCG

   

AJ234403

cMWG0650

CCTCATCTCTTGGAGGCACACTGTG

287

58-60

GG/CMWG650-5

 

GCCATAATGCGAGCATTGTGCCAT

   

GG/CMWG650-5

cMWG0652

GAGCTGCTCGTTCTCGTTGA

417

55-58

AJ234404

 

CACACCTTCTTCTTCCTCTT

   

AJ234404

cMWG0654

GTCCACGCCGTCCCCGATCT

~500

52-55

AJ234406

 

CCGTCATCAAGGTTGGAGCA

   

AJ234406

cMWG0655

CCGTCATCAAGGTTGGAGCA

151

55-58

AJ234407

 

GGAACATAGGTAGATAGGTG

   

AJ234407

cMWG0658

CCAAGAAGGCGAAGAAGGTCC

240

62-65

AJ234408

 

CTCACTGCCCAGAGAAACAGC

   

AJ234408

cMWG0660

CTGAACCCACAAGAGCAGAA

~1000

55-58

AJ234409

 

CCCAGCCAAAGCTGGTTTTT

   

AJ234409

cMWG0663

GAGGATGACAACGTCTCAGC

451

55-58

AJ234411

 

AAGCACCAGAATTAGCCTGG

   

AJ234411

cMWG0669

CTTGCTCGGTTGACTGTGTT

499

55-58

AJ234412

 

GCTGCGGCACCTGAGTTAAA

   

AJ234412

cMWG0676

CACTTCACCTTCACCAGCCG

202

55-58

AJ234414

 

TGAGGACGATCAGCGAGAGC

   

AJ234414

cMWG0679

GAGCAGCCCGTGACATGGAA

196

60-62

AJ234416

 

CTCCACCAGTGCAACCTCGT

   

AJ234416

cMWG0680

CGCGCAGACTCTGCCGCTAA

~1700

60-62

AJ234419

 

GCATCAGCAGCTCGCTGGGA

   

AJ234419

cMWG0681

CATGTCTGCCTGTGTCATGGC

~330

55-58

AJ234420

 

TCGACGCCTTCCTTGAACG

   

AJ234420

cMWG0682

TTCGACCAGTAACAACGCCC

295

58-60

AJ234421

 

ATGTCCTCATCTGCAAGCGC

   

AJ234421

cMWG0691

CACCATCGCGAACAGTACAT

235

58-60

AJ234423

 

GGTTGTCCCAATAGGTGCAG

   

AJ234423

cMWG0696

TTTGGAGGGAAGGAGGGAGC

346

58-60

AJ234425

 

TGGCGATGATGATGATGACCG

   

AJ234425

cMWG0699

CACCTTGATGTCCTCCTATA

336

55-58

AJ234426

 

GATTACCCCTGAGGAGCATT

   

AJ234426

cMWG0701

CATTGCAAGACGACCGTTCTTGATC

273

55-58

AJ234428

 

GGTTCAAGGCGGCTCCAGATCTTCA

   

AJ234428

cMWG0703

CATCATAGCCGTCTGTATGGG

~1130

55-58

GG/CMWG703-5

 

AATGTCCGCTTTGGAGTCAGG

   

AJ234429

cMWG0704

AATGTCCGCTTTGGAGTCAGG

236

62-65

AJ234430

 

ACCAGACACCACAGAGGCACA G

   

AJ234430

cMWG0705

CGTGGCAACACAAAGTTGGC

~800

62-65

AJ234431

 

ATACCTCCCTCTAACGCCGACC

   

AJ234431

cMWG0706

GGGCAAGACTGTGCTGGAGC

~1200

58-60

AJ234432

 

CCAGTGGATTTGTACTGCAC

   

AJ234432

cMWG0714

GCCACGACGGCCTCATAATC

309

55-58

AJ234433

 

ACAACACCAACCACCCCAAAG

   

AJ234433

cMWG0716

CCTGGGAGGTGAAGTTGGCT

335

55-58

AJ234434

 

GACCAGATCAACGAGCCCAA

   

AJ234434

cMWG0717

GGAACGATCTCAGAAACGGATTCG

219

52-5

AJ234436

 

CTCTGGAAGTTGTCGCTTCTCAGC

   

AJ234436

cMWG0720

CTCTGGAAGTTGTCGCTTCTCAGC

193

55-58

AJ234437

 

GACTTCTTGACACGATCATT

   

AJ234437

cMWG0721

CTTCACGGACTTGACCTGG

349

58-60

AJ234438

 

AAAGCAATAACTCTGCCTGG

   

AJ234438

cMWG0725

GCGAGGAGAAGAACAAACACG

233

60-62

AJ234439

 

GCCTAGCCATCTAAGAGAGGG

   

AJ234439

cMWG0728

TACATACATGCTTGGCTTCC

184

55-58

AJ234440

 

CGTAAAGTTAGGTTGGCTACG

   

AJ234440

cMWG0729

ATGGCAAGCCAACAAACATC

76

58-60

AJ234441

 

GTTGCGTCCATAATTCAGAGG

   

AJ234441

cMWG0733

GCGGTGGTACAAAGACAAAGTCCA

182

62-65

AJ234442

 

CTGCATACATGTTCGTCGATACTAAG

   

AJ234442

cMWG0740

GGCGAAGCAGGTGTCAGT

293

58-60

AJ234444

 

TCTGCAATTGCACCACTCA

   

AJ234444

cMWG0741

CTTGAGGTTTGAAGAGGGTCC

~700

58-60

AJ234445

 

TGTTCCATTGGGCACTGC

   

AJ234445

cMWG0758

GGTGGTGAGTAATAGGACCAAGGTTT

203

55-58

AJ234446

 

CTATTAACGACGACGGCGACG

   

AJ234446

cMWG0763

CATTCATGTCAGCGACGG

355

58-60

AJ234447

 

TAGCCAGTCCAACAGCAGC

   

AJ234447

cMWG0770

CATTCGGACAGCCCAGCTCA

195

60-62

AJ234450

 

GGCTATGGAGGGTGGGGGTT

   

AJ234450

cMWG0773

TGCCCAATTAACCATGAACC

228

52-55

AJ234451

 

TCAGGCTCTGAATGAATCTCG

   

AJ234451

cMWG0781

ATTCCGGGTCTTCATTCAGG

~400

55-58

AJ234452

 

CTTACGCAGCAATCTTGTCG

   

AJ234452

cMWG0784

CGACATAAGGGTGAGATTCAGC

266

58-60

AJ234453

 

GGGTGGACAAATTACACTGGG

   

AJ234453

MWG0014

AGACGGACTACGATCCGAGC

92

58-60

AJ234455

 

ATACCTTGCCAGCCTCTATGC

   

AJ234455

MWG0058

CATGTGTGGCCATCGAGAAA

198

58-60

AJ234459

 

GTGTGTCTAGTCTAGACACT

   

AJ234459

MWG0065

CTTGTAGCAGCGCAGGAGGA

201

55-58

AJ234461

 

GGGTCAAAGATAGGTGGTGT

   

AJ234461

MWG0080

CTTGTGTCCAGATCACACAT

200

58-60

AJ234466

 

GGCAATTGTGGAAGTCTCTA

   

AJ234466

MWG0089

GGCTGCTGCAATGTTTGC

~470

55-58

AJ234469

 

TGCCTTTGGTTGATGGCC

   

AJ234469

MWG0502

TGTTTAGCTAAGCTGTTGCTGAGG

442

52-55

AJ234471

 

CTCTGAAGCATGGAACCAGATTTG

   

AJ234471

MWG0503

CGCCACACGTAGAGTATGTT

413

52-55

AJ234472

 

GACGACCAGATCAAGCATGA

   

AJ234472

MWG0506

TCTGTGTCTTGTGGAATTAGG

220

55-58

AJ234473

 

TCTATGGAATCATGGGATGG

   

AJ234473

MWG0511

CTCATCCTCTTGTTCAGGAGC

~1100

55-58

AJ234475

 

TAGCTGCGGCATGTGTTCG

   

AJ234476

MWG0514

GTGCATTAATACAGTGCCCA

472

50-52

AJ234478

 

CACAAACGTTACGAGTACAG

   

AJ234478

MWG0522

CTCACCTGTCTGTATGCACGCATGC

~1170

60-62

AJ234482

 

CACAAGGATCAGCAACTGTGT

   

AJ234483

MWG0526

GAGTGGCTCATCGTATTGCACTCC

279

52-55

AJ234484

 

GGTACTCTGCTTTCAGAGGTATTTGA

   

AJ234484

MWG0527

AGACGGGGCTGGACATGAAGG

311

58-60

AJ234486

 

GATGATGGCCTCACATCTGCG

   

AJ234486

MWG0528

GCCCATCTGCGGCATCATGG

160

58-60

AJ234488

 

TTCGTTCCAGGACACGGCGG

   

AJ234488

MWG0530

CGATCTGGACATCGAAAGCC

178

58-60

AJ234489

 

GCTAGTGCTCTTGCCAAGTCG

   

AJ234489

MWG0533

TGTGAGACTGTGACCGCTGG

181

55-58

AJ234492

 

ACGTGTGTGGCTGTGTGTAGG

   

AJ234492

MWG0539

GCACTGCCCAATTCTTGC

~900

55-58

AJ234493

 

CTTGATCTCCTTCGGGAGCG

   

AJ234494

MWG542

CACTCACAGGCTTCGTTGCT

245

58-60

AJ234495

 

GCTCTGCTCTGCTCTGCTCA

   

AJ234495

MWG0549

CTTAACTTTTGAAGGGCACG

392

60-62

AJ234498

 

GCAGGTGTGTCATCAGTGTA

   

AJ234498

MWG0550

CTGACAATGTCGCCTGTATGTGTA

421

52-55

AJ234499

 

GACGCATTTGTTCATACAACCTGA

   

AJ234499

MWG0553

TACAAGAACTCGAGAAAGATGCCA

483

55-58

AJ234501

 

CTGAATTTGTGTGGTGTCTTGTGT

   

AJ234501

MWG0555

CGATTTGTTGGCACACATCA

213

52-55

AJ234503

 

GCAGTATCATCTCACCCGAA

   

AJ234503

MWG0557

GGAAGCCACTTTGAAGCAAA

333

55-58

AJ234505

 

CAAGCCAAATGCTAACCAAT

   

AJ234505

MWG0561

GTAGCGTGTGCGCGTGTACTAGTTGC

388

58-60

AJ234507

 

GGAGTGACCCTAAGCACTGACTGACT

   

AJ234507

MWG0564

TCTGTTTGGAAGGCTTCTGCC

227

55-58

AJ234508

 

ATACGGCTACTACGCCGACTGG

   

AJ234508

MWG0573

CTGCACTCATGTCAGCAAGA

240

58-60

AJ234515

 

GACCAACGGGAGATGCTCGT

   

AJ234515

MWG0577

CTCGGGACTTTCCCTATGCT

580

55-58

AJ234516

 

GTTGAAGTCCTCTGATCCAG

   

AJ234516

MWG0578

CCGCAAGACGGAGATAAAGCG

234

55-58

AJ234518

 

TGTCGCCGGACAAGTTTGGC

   

AJ234518

MWG0582

CCTCAGGCTGGTTGAAGAAGC

488

58-60

AJ234518

 

GCCGACAGTTTGTTCTGACCGATAC

   

AJ234518

MWG0583

TGTACGCAGGGAAACAGGTCGTTC

350

55-58

AJ234522

 

GTCCAAGCAGAGAGAGAGATTCCG

   

AJ234522

MWG0584

GTATTCTTGGAGGAGAGCGG

365

55-58

AJ234523

 

CGAGGTTTACCCTGGAGACG

   

AJ234523

MWG0595

TGCCGGTGGTATTGTCG

223

58-60

AJ234526

 

TCGGCAGTAGCACAGGTATG

   

AJ234526

MWG0596

GTGGAGTCAGCCAGGTTTCCGTATCT

306

58-60

AJ234528

 

ACAGATGGAAATATAACCCCTATAG

   

AJ234528

MWG0599

GACGCTGCGTGAGTCTTTGG

~600

60-62

AJ234529

 

TAACTCGGCAACCCGGAATGC

   

AJ234530

MWG0602

CCACTGTATGAACACAGGGA

271

55-58

AJ234531

 

GACCACAGGAAGAGGTCGTT

   

AJ234531

MWG0604

GCAGCCGGAGCAGCAAATAGC

~500

58-60

AJ234533

 

CTGTCTGTTTGCTGATCTTGTT

   

AJ234533

MWG0618

TGATTGTATCGGATGATTGC

180

60-62

AJ234539

 

AGCTGAGAAATGAAGAAGGG

   

AJ234539

MWG0622

TGCAGCCGTGAAGGTATCG

~1100

58-60

AJ234540

 

AACCATCAACGTCTAGCTCCG

   

AJ234541

MWG0626

CGGACACGCTGCTTCAATCC

307

62-65

AJ234544

 

ACAACGAGATGACGGTGCCG

   

AJ234544

MWG0632

CAACAGCAGCACAAGGTCGCTGCCT

473

55-58

AJ234546

 

GGTGGAAGCCAAGTCTGACATCGTC

   

AJ234546

MWG0633

TAGTATCGGATTGATCCAGGC

767

58-60

AJ234547

 

TTAAGAGGGTGATTGCCACC

   

AJ234547

MWG0635

ACCGACGCAGACCTTCAG

178

58-60

AJ234550

 

TCAAGACCATGAAGCACGAG

   

AJ234550

MWG0793

TGCCCAATTAACCATGAACC

177

55-58

AJ234451

 

TCAGGCTCTGAATGAATCTCG

   

AJ234451

MWG0798

GGCTGTCTACATCTTCTGCA

365

55-58

AJ234554

 

CAAGTGTTGAGAAGGAGAGT

   

AJ234554

MWG0799

TGCAAACTTGATGGCAGGCC

~500

55-58

AJ234555

 

TCGGCGGCCTTGAGGTTGC

   

AJ234556

MWG0800

GTCCGTAACCTGTGGTACTG

400

55-58

AJ234557

 

GCAGCTAAGTTGGCTAGAGC

   

AJ234557

MWG0801

GAGTAAGCCCTATGTATCAA

265

52-55

AJ234559

 

CAGTTGAGTATACAGTTCCT

   

AJ234559

MWG0802

CTTGCTCTGCGTACATCCCG

371

52-55

AJ234561

 

CACACGGAATGGAGTGCTCG

   

AJ234561

MWG0803

GGTCTTTTCCAACGCACTATCCAGCC

442

58-60

AJ234562

 

CCCAGAAGAAAACACAGGCCCACAA

   

AJ234562

MWG0807

TACTGGGTGTTCGGTGTGGC

337

58-60

AJ234563

 

AATTCCTGCATTCCAAACGG

   

AJ234563

MWG0808

TCGCCCAGAGACATAAAGC

233

58-60

AJ234565

 

ACACCCAAATTGACGTTGC

   

AJ234565

MWG0812

GCGTAGCAGCAAGGCAGCAA

495

58-60

AJ234567

 

CGAGCATACTACTACCAGCG

   

AJ234567

MWG0813

TTGGACAGGATGTTGCCA

115

55-58

AJ234568

 

CATTCAGTAACACCGCCATG

   

AJ234568

MWG0815

TCTCAGCATCTCAGCATACGG

349

55-58

AJ234570

 

AGGGATTTGGAAAGGACATCC

   

AJ234570

MWG0820

GGGGAGAAAATGCATGCAAT

265

55-58

AJ234573

 

CAGCGTCGTATAAATGTCTT

   

AJ234573

MWG0825

AGCGGCTAGTATCGTTGTCGC

119

55-58

AJ234574

 

TACGGAGCTAGGACGACCACGG

   

AJ234574

MWG0832

TGGACGGGAAGAAGCAACGG

~1430

60-62

AJ234578

 

AAAGGCTACCGGGATGACCG

   

AJ234579

MWG0835

TTCCCTATTCAAGCCATCAGCAAA

565

55-58

AJ234580

 

GTAACCCATAGATAGCATCTTGTG

   

AJ234580

MWG0836

AAAGGTCTAGCGGCTACCG

263

55-58

AJ234582

 

TGCCCGTGACAAGTGTTGG

   

AJ234582

MWG844

TCAGGAACCTGGCACCAACG

374

58-60

AJ234585

 

CATCAGCCCGCGATACATCC

   

AJ234585

MWG0847

GTCTTGGCCAGCTACTCCCG

345

65-67

AJ234586

 

CGCACCTGCACCAGAGGTCC

   

AJ234586

MWG0848

CGCAGGGTACACATCCACAT

236

52-55

AJ234587

 

GAGAGGACCAGGGAAGACTT

   

AJ234587

MWG0851

GTGCAATACCAGCAAACTCA

301

58-60

AJ234592

 

CATAGCAGAACGTCTCAAGT

   

AJ234592

MWG0852

CTATGCTCTTCTTCAGTCCA

306

55-58

AJ234594

 

GTACTGTGGAACTTCCAGTT

   

AJ234594

MWG0858

CGCCTCGTCTGTCATACTCA

271

60-62

AJ234595

 

AAAGAGGATGGCAGCCG

   

AJ234595

MWG0862

AATACTTACGCACGAGAGCC

265

52-55

AJ234598

 

GCTATGCACAAACGATTGG

   

AJ234598

MWG0865

GCCCTGTTGCTGTACTAAAA

306

55-58

AJ234600

 

CTAACGAACTGTGCATGATT

   

AJ234600

MWG0866

CATGCCCAATGTTGATCGGA

~400

55-58

AJ234601

 

GTTCAAGCATTGGCTCCTCT

   

AJ234601

MWG0872

GACCAGAAGCTAATGGCGAT

276

55-58

AJ234603

 

CGTTCACACTCAAGCCCTCA

   

AJ234603

MWG0874

ATAATGGCACACAGGATGCC

388

55-58

AJ234604

 

GCACTCTTTGCTCGTATGGC

   

AJ234604

MWG0877

CCGTGATACACCTGGTGATATATG

~1150

58-60

AJ234608

 

CACAAGAAAGCAGCTCCTCCATT

   

AJ234609

MWG0878

CTGTCTGCTTGTGCAAATGG

272

52-55

AJ234610

 

GCTTGAATCTGGTATGGTGC

   

AJ234610

MWG0880

ACTGGGCTTGCAGTTGCAGAC

139

60-62

AJ234613

 

GAGAAGGGCATGAGGATCG

   

AJ234613

MWG0882

GGAAGCTGGCCAACTTGCAA

414

55-58

AJ234615

 

CTCCATGACTGACAGCAGCT

   

AJ234615

MWG0884

GGAGCCGCCAACATATTTGG

374

52-55

AJ234619

 

CACTCACAAGGTATGGTTCC

   

AJ234619

MWG0887

GAAGATGTCAATCAAGGGTT

276

55-58

AJ234620

 

CAGCCTACAAGCAGACAAAA

   

AJ234620

MWG0889

CCCTGAATTCACGCGTTATT

378

55-58

AJ234622

 

GAATGAGCAACTACCGCATA

   

AJ234622

MWG0891

CAACTAGCAAGGCATGTTCA

177

52-55

AJ234625

 

GGAGACGACACAAAGTGAAA

   

AJ234625

MWG0892

CAGAAGTAGAGGAAGCTCTT

327

55-58

AJ234626

 

GCCCTTTACATTCAGTCGAA

   

AJ234626

MWG0896

GCATATTGCGGTCCATGTACC

695

55-58

AJ234630

 

TTGCTTGCAGGGTGACTAACC

   

AJ234630

MWG0902

CTGGGAGCATGGTGATCACA

300

52-55

AJ234635

 

CTTGCCGGCCTCATCAAAAA

   

AJ234635

MWG0903

GAAGACACGGTTTCGTGATC

223

55-58

AJ234638

 

CCGCCCAGTGAGATATTGTAG

   

AJ234638

MWG0904

GTCGATCACGCATTTCCTCCG

272

55-58

AJ234640

 

TGTTCCCATTGTCCACCAGCG

   

AJ234640

MWG0911

GATGTCGTCGACGTAGAGAA

291

52-55

AJ234641

 

CATGGCCTGTACATCAGCTT

   

AJ234641

MWG0912

CACAACCATACAAGCAGGCG

400

52-55

AJ234642

 

TGGCAGATTTGATCGACTCC

   

AJ234642

MWG0913

GCACCCTTGAAGCAGACATCG

370

55-58

AJ234643

 

GCCATGAGCGGGAATTTGC

   

AJ234643

MWG0914

GCCATGACCGTCTTCCC

269

58-60

AJ234644

 

CCCCATAACATTCGGGTATG

   

AJ234644

MWG0916

GCGGACCAGATCAATATCGA

196

55-58

AJ234646

 

CGACGTAGGGAAACACGCAT

   

AJ234646

MWG0920

GTCACCGCCCGTCACGTTGCGCTTCA

183

58-60

AJ234647

 

GAGTACCGCGACCGTCGCGCTCGAGC

   

AJ234647

MWG0932

CAGCCATTTCAGACATTGCACATGCT

336

58-60

AJ234652

 

GGAATCAGTATTGGCATTGCATGGTG

   

AJ234652

MWG0933

AAAGGAGTCTGGGTGGAAAGC

301

52-55

AJ234654

 

ATGGATTGCCTGGAAACTGC

   

AJ234654

MWG0934

GTGTCGTCCAGGTAGTACTT

314

55-58

AJ234657

 

CCGGCACCACCAACTTTGAA

   

AJ234657

MWG0939

GCGAGAATGGAAAATCCGCT

191

55-58

AJ234658

 

CCCGGTGATTGAGTGAATGA

   

AJ234658

MWG0943

GACGTTCGCCTGCGCCATGAGCAAC

295

55-58

AJ234660

 

CTTGTAGAGCGTCATCAGCATCGCG

   

AJ234660

MWG0948

GCATTCCGTTTGGACTATGG

283

55-58

AJ234664

 

CGTCGCCGATATTTGTAAGC

   

AJ234664

MWG0949

CGGCTGGTAAATGAACTGAA

~1800

52-55

AJ234666

 

GGCTTCCGCTACTACGTCTT

   

AJ234667

MWG0951

GGAAGTTCATCAAATTGGAA

410

55-58

AJ234670

 

GCACACACATGTGTATTTTT

   

AJ234670

MWG0952

GTGGCAGAATTGTGATAGCT

330

55-58

AJ234671

 

CGGGGACGTGTTTGAGAAAA

   

AJ234671

MWG0954

GGAGAGAGGAAAAACTGAAGCAATC

~400

55-58

AJ234673

 

CAGATTATACGAACCATGCAAAGTG

   

AJ234673

MWG0957

TGATGTGGTGTTGCCGAGC

254

55-58

AJ234678

 

CTTCATAGCCCCTTCCTGTGC

   

AJ234678

MWG0961

GCCGAACCTGAGCTTGTACA

449

55-58

AJ234679

 

CGCTATCCTCGAGTACGACT

   

AJ234679

MWG0966

GATCAAGCAAGCTAGCTCCA

328

58-60

AJ234682

 

CACAGATGCCACACCGGAAT

   

AJ234682

MWG0967

GCGACGGGCAGCAAGAAAAA

171

58-60

AJ234683

 

CTGAGGGCCAGTGGGATCTT

   

AJ234683

MWG0969

CTGCCTGTCTGTATGCATCCAACACG

~1000

58-60

AJ234685

 

CACCGATGTGATGGCTGCTGCTGCTC

   

AJ234685

MWG0973

CAACAAGTCGTAAATCCCGTGAACCC

255

58-60

AJ234690

 

GATAACTATGCATGTTGAGAGGGACC

   

AJ234690

MWG0974

GGAAGAGATCACCGTACTCT

313

52-55

GG/MWG974-3

 

CACTTGAATCTGCGCAAGGT

   

GG/MWG974-3

MWG0975

GATTGCCACATCGCGAACAGGCCTGC

178

58-60

AJ234691

 

GTACTGCGTGGTTGTGGACGTGGCTT

   

AJ234691

MWG0977

AACCTGAATAACTGCTACGGC

195

55-58

AJ234693

 

TGCTGAATTTACTTGCTGCC

   

AJ234693

MWG0980

GTTGCCAGTGTTGGGCTTGGG

294

62-65

AJ234696

 

ACGCCACCGTGTTGCAGTGG

   

AJ234696

MWG0984

CTCATGCTCGCCGTCAGGTC

184

58-60

AJ234699

 

GTGAGGTGGCAGACGTGTGA

   

AJ234699

MWG0985

GCCGCTGGGATTGGAGGATT

329

60-62

AJ234700

 

CATGTCTTTGGGGGTCAGGA

   

AJ234700

MWG2018

TCGACGGCAAGCTCCTGACC

342

62-65

AJ234706

 

GCGACGGCAGTATGGTGAAGC

   

AJ234706

MWG2020

TGGAATGACAAGGCCGTGG

210

60-62

AJ234707

 

TTCAAGGTGAAGGGCTCGC

   

AJ234707

MWG2021

GTTCCACTGGATGCACCACA

401

58-60

AJ234710

 

CATCAAGCCTCACAACATCC

   

AJ234710

MWG2026

CGAGCGGAGAGAGGTGAG

253

58-60

AJ234714

 

TCTGGTTTCGCAGAACTGC

   

AJ234714

MWG2028

GCTCACATCAATGTGTTCCGACAGC

242

60-62

AJ234716

 

CATGAAGGAAGGCACCACGACTGAA

   

AJ234716

MWG2029

CCAGTTATCCGAATCCGGAA

245

55-58

AJ234717

 

GTGGTCAGGTACATACGAAT

   

AJ234717

MWG2030

TTGCCGCAGTTCTCTACTCC

~1100

52-55

AJ234719

 

CGCGACAATAAGGTATTATGC

   

AJ234720

MWG2031

AACGCTCTGTGTTTCCAGACC

~1200

58-60

AJ234721

 

TGCAGTATGAGTTGCCAGC

   

AJ234722

MWG2033

GGCTGTTGACCCAGTAAAAT

231

55-58

AJ234723

 

CAACATAGCTGTACCGTGTA

   

AJ234723

MWG2036

CCATCTTGAAAGCAGCATCA

190

58-60

AJ234727

 

TGCTGACACAGCCCTTTTC

   

AJ234727

MWG2037

GCCTTGGATGCCATTGCTTA

266

55-58

AJ234729

 

CATTCCTCTACCGAACTGAA

   

AJ234729

MWG2040

GATGAGATGTGACTTCGACA

319

55-58

AJ234731

 

CTTCACAACATGCCTAAGAT

   

AJ234731

MWG2046

ACATCCTGCGGCACATCTGC

342

62+65

AJ234734

 

GCTCCACTTGTTCATGCAAGC

   

AJ234734

MWG2053

CCCCGGTATCCTCAAATGCA

~1350

55-58

GG/MWG2053-5

 

GTTTTCGCGACGATGTCCTT

   

GG/MWG2053-3

MWG2054

CAGGCTTCCGTTAAAGTGTA

~950

55-58

AJ234736

 

GCTCCGTTCCTTTGATTGTT

   

AJ234737

MWG2056

GTCGTGGCCTGTAACAAAAGGCTATA

757

60-62

AJ234738

 

CAGTTTATGCTCGCTCACATCACCTT

   

AJ234738

MWG2058

GTCAAGCAGAAGTCCTTCAA

~570

55-58

AJ234739

 

CCACTCATCAACCACCACTC

   

AJ234740

MWG2061

GAGTGAGGTTCGCCTTCAAA

194

55-58

AJ234742

 

CGCGACCAACATTCTGATGT

   

AJ234742

MWG2062

TCTCGCTGGTATTCAGGGTCC

281

60-62

AJ234743

 

AAACGATAGCAAGAGGAACCG

   

AJ234743

MWG2065

GGGAGCACGAGGGAGACGTT

266

62-65

AJ234746

 

CCTCTTCGTGCAAGCTTCGA

   

AJ234746

MWG2067

GTTAGTTACTGCTGCCGGAA

256

55-58

AJ234748

 

CTTCCTCCGAACCGCAGCAT

   

AJ234748

MWG2068

CCGTGAGATGTAAGTTGCTGG

~700

55-58

AJ234750

 

ATGCGTTGGCCCATTGG

   

AJ234751

MWG2072

TAGCCGGTTCAGTAGGAGTCG

194

58-60

AJ234753

 

ACACACAGAGGTTTGGCACC

   

AJ234753

MWG2074

CTTGCCCACTTACCAGGTGG

309

58-60

AJ234754

 

ACGGGATCTCCTTATGGAGC

   

AJ234754

MWG2076

AACAGACTGAGCAGTGTGGCG

228

58-60

AJ234756

 

ACATTGGCGTCACGACATCCC

   

AJ234756

MWG2077

CTGGTTAGAGTTTCCAGCCCAACCAT

234

60-62

AJ234759

 

GGGAAGATTGATGTTTCCCCTGCATA

   

AJ234759

MWG2081

GAGTGGGGAGATCGTGACAT

108

60-62

AJ234763

 

AGGAGAATTCTTGCCCTGGT

   

AJ234763

MWG2086

GTTTTCTTTTCGCCAAGACC

238

52-55

AJ234765

 

CGGAGATACTTCAACAAGTGC

   

AJ234765

MWG2088

CAATTCTCTCGATGAGGCCG

336

58-60

AJ234767

 

GGCGGGATCAAATCTTAGCC

   

AJ234767

MWG2092

CCACTCGTGGAATCCCTTGG

~600

48-50

AJ234769

 

TCTCTTCTCCGGTCGTTGTCG

   

AJ234769

MWG2097

CCTTCACCACCATGAAGGCA

351

55-58

AJ234772

 

GAGTCCATGGACAACAACCT

   

AJ234772

MWG2100

GAATTGTTTCACGGGCAGTT

259

58-60

AJ234776

 

TAGAGGAGGACAAACCCTGC

   

AJ234776

MWG2105

CAACCTGCTAACCAAGCTACG

364

55-58

AJ234778

 

TCTGAATGGACAAATGGGTGC

   

AJ234778

MWG2110

CAAAGAATCCGTTGATTGCT

180

55-58

AJ234780

 

GGCACTTTTAAGTTTTACGA

   

AJ234780

MWG2112

GATCTCCGGGTGGTTCACCA

259

58-60

AJ234781

 

CGTGCGGGTAGCCTAGGTGT

   

AJ234781

MWG2121

AAGACATTTCTTCTGCGTGC

338

55-58

AJ234783

 

TCCTACCAACTCCATGATGG

   

AJ234783

MWG2123

CGAGAGCTTGAGAGCCGTCA

247

55-58

AJ234786

 

AGAGGACCAGAGCAGCAGCT

   

AJ234786

MWG2132

AAGGACGTTCTGGAACAGCCC

404

58-60

AJ234789

 

TTCGACTTCGCCAAGGTGG

   

AJ234789

MWG2133

CTTTACCACGGTCTATGTCA

380

52-55

AJ234792

 

GGTAAGACATGGAGGACCAT

   

AJ234792

MWG2134

GCAACTCAACGCCATTCCAT

258

55-58

AJ234793

 

CCAGCGTCTTTTCATGGGTA

   

AJ234793

MWG2135

GAAGACAAGCAGCAGCGACG

~700

58-60

AJ234795

 

CAGGTATGCTTCGTGATCGCG

   

AJ234796

MWG2137

CCCGTCGATCGATCGATCAA

268

55-58

AJ234797

 

GCTACTGTTTCGCGGTTGCT

   

AJ234797

MWG2138

CGAGGCTGTGCGGCACGAAG

379

65-67

AJ234799

 

GGTCTGCCCCGTCTGGATCG

   

AJ234799

MWG2141

GCAGGATGAAAGGTGATCG

153

58-60

AJ234802

 

GGGAGTAGAAAGGAAACCG

   

AJ234802

MWG2146

CTGGCTTCCGATGCAAAGG

324

55-58

AJ234803

 

TTGGCCTGTTGGGAGATGG

   

AJ234803

MWG2157

TTGGTTCGGGACACACCACG

200

62-65

AJ234807

 

ACAAACTTGCGGCACTTGGC

   

AJ234807

MWG2158

CTGAAGCCAATGGGCTAGAA

~1000

60-62

AJ234809

 

GTGATAGCACCTCGGTCACA

   

AJ234810

MWG2163

GACGGCCTTGATTCATTTCG

194

60-62

AJ234815

 

AATTGGAGGGAAGCAGTGGC

   

AJ234815

MWG2170

CAGGGTGTGATGAAGAGTGC

370

62-65

AJ234817

 

ACGTGCATGGTCTAGCCAG

   

AJ234817

MWG2171

TTTGTTCAAGCACCCGTGTCG

247

55-58

AJ234820

 

CCCATAAATCCTGAGCAGTGG

   

AJ234820

MWG2180

TGGCAACGAAGACAGAAGG

172

58-60

AJ234821

 

GACTTTCTGCGGAGCAAATC

   

AJ234821

MWG2186

CGACAAAGCGCGGATGATCC

347

58-60

AJ234824

 

GTGATGGCACAACCGAGATGG

   

AJ234824

MWG2187

AAATAGCTTGGCGTAATCATGG

121

62-65

GG/MWG2187-5

 

AGCTCACTCATTAGGGCACC

   

GG/MWG2187-5

MWG2189

GGCGACAATTTGAAAGTACGC

148

58-60

AJ234827

 

ATGTGGTCCATCTTGAGGAGC

   

AJ234827

MWG2190

TCCAGCCCAACAGGTGATGG

286

58-60

GG/MWG2190-5

 

GCATGACGATGAAACAGGACG

   

GG/MWG2190-5

MWG2193

CAAACCCTTGAGGTCAGTTGC

462

55-58

AJ234828

 

TCAGCTCTAAGATGCAGCACG

   

AJ234828

MWG2196

TCCGCAAGACCTACGAAGCG

174

55-58

AJ234830

 

TCTTCTTCCCTTCTCCCGCC

   

AJ234830

MWG2200

ATCCTGGAGTACCTCGAAGCCG

272

52-55

AJ234832

 

CGATGGACGTGCATCTAAGTCG

   

AJ234832

MWG2205

ATTTCCACTCGCCTTCCG

253

58-60

AJ234835

 

GAATGTTAGCTCGTCGGGC

   

AJ234835

MWG2211

GTGTCCACTCAATTTCTCGG

428

52-55

AJ234838

 

ATGTTCCTTGCTGATGGCG

   

AJ234838

MWG2212

CCGCCGTTGTACGGGAAGAGG

185

62-65

AJ234839

 

TTCTCCGCCCCACTCCATAGC

   

AJ234839

MWG2214

ATTGGCATGGAACTACCAAGC

197

55-58

AJ234840

 

TCTGAAAGATAGCCTGCAAGG

   

AJ234840

MWG2216

GCTGGAGATGTTCTTCAGGG

207

55-58

AJ234841

 

ATATCACACCGATTGGAATGG

   

AJ234841

MWG2217

CGCACGACAACAACATCATGC

284

58-60

AJ234842

 

ATCAAACCGACGAGCCTCACC

   

AJ234842

MWG2218

TGAAGTCGGTGTAAGGGTCC

200

60-62

AJ234843

 

ATGACCGTGACGACAACGT

   

AJ234843

MWG2223

CTTTCAGAAATCTCGGTCCG

413

55-58

AJ234845

 

TTTGTCCTCGACTACTCCTGG

   

AJ234845

MWG2224

AGCGCCGGAGAATAGGAGGC

135

62-65

AJ234846

 

CACCAGAGTCCACCACGAAGC

   

AJ234846

MWG2227

TAGCCTTGCCTCCGAAGAGG

~500

58-60

AJ234848

 

AGATGACGACACGCCAGACG

   

AJ234848

MWG2231

TTCATCTTAGCTCCAGCCAA

250

55-58

AJ234850

 

GCCATTGCTCTGTTAACGAA

   

AJ234850

MWG2232

CCTGTGGCAAGACCTATTGC

210

58-60

AJ234852

 

GTGTGTCAGCATGGACATTCC

   

AJ234852

MWG2233

TGCGCCGCTTCTCTCTAAGC

236

55-58

AJ234854

 

GCCGTCAAGCATGATTTGCC

   

AJ234854

MWG2234

GTTCTTCAGTACACCAAGTGC

236

58-60

AJ234856

 

GTTCTTTAACCGCAACGG

   

AJ234856

MWG2236

GCAAATGTGCCTTGACCC

642

55-58

AJ234857

 

CTTCCAAATGGCGATGC

   

AJ234857

MWG2240

TGATGTGAGGATGTTGTGGA

293

58-60

AJ234859

 

TGTGCCACCTCATGCAGT

   

AJ234859

MWG2243

ACAATGCCGGATTTGTCCG

282

58-60

AJ234861

 

AAGATGAACATGCTGCGTAGC

   

AJ234861

MWG2246

GTATTCATCATCCAAAGTAGCC

293

52-55

AJ234862

 

GAAACCTTCAAGATCGTACCC

   

AJ234862

MWG2247

TTGGGTCAATCACGCTCTCG

358

58-60

AJ234863

 

GGCTGTCAAAGGCTTTCAGC

   

AJ234863

MWG2249

GGCATGTGAGGGAAGCAATGG

327

58-60

AJ234866

 

TGGAGAAGAACGTGTGGGTCG

   

AJ234866

MWG2256

CCACGCATTTGTTGGTTCG

239

55-58

GG/MWG2256-5

 

TCTCCCTTGGTATGGTGAAGG

   

GG/MWG2256-5

MWG2257

GCATGTGATGCCCGATTGC

~600

58-60

AJ234866

 

CCACATTAACCGCCGGAGACC

   

AJ234866

MWG2259

TGATGGGTTCGCAAAGACG

231

55-58

AJ234867

 

TCCCTCTATGACATGGGCG

   

AJ234867

MWG2262

AACCTGCACATCTCCGGTCC

260

55-58

AJ234869

 

TGCTGCTCGACGAGTTCTTCG

   

AJ234869

MWG2264

ACGGTGTTAGCGCAGGAC

427

55-58

AJ234870

 

TGGGATGGCATATCTTCGA

   

AJ234870

MWG2266

GTCACCAGTTGTGTAAGGTGG

377

60-62

AJ234871

 

AACAGGAGGTTGTTCAGCAGC

   

AJ234871

MWG2268

TCGCAACGTCACACCGACAGC

347

60-62

AJ234872

 

GCCGGAGTGGACAAACCAACC

   

AJ234872

MWG2269

ACTCCACGCTGCTATGTTCG

334

55-58

AJ234873

 

AAAGCCGTCATTCCGACTGC

   

AJ234873

MWG2270

TGCTGCTGCCATCCATCGC

282

60-62

AJ234874

 

CATGCTGTTCGTCCTCGTCGC

   

AJ234874

MWG2271

GGCCCAAAGCCTTCCAATGTC

302

55-58

AJ234875

 

GAGGTTCCAAACGCAGCAAGC

   

AJ234875

MWG2279

TGATCGAACGGTTGAGATGG

311

55-58

AJ234877

 

GCGGTGGAGGGATTTATAGC

   

AJ234877

MWG2282

CTTTCGCCATCACCATAGTGG

364

55-58

AJ234878

 

AAGATTAGAGGCCAGACATTGC

   

AJ234878

MWG2287

CACAGCATGGCTGAGGAGT

274

58-60

AJ234879

 

TGGAATCGTGAGCTTGAGG

   

AJ234879

MWG2290

CATGTTGTACCATTTCCCTGG

291

55-58

AJ234880

 

TTGAGAGCTACGATCTTCTGG

   

AJ234880

MWG2291

TCGTTCGTTGTGTGAGGGTCC

245

55-58

GGMWG2291-3

 

TGGAGATCGCCTGTGTGTCG

   

GGMWG2291-3

MWG2297

GGCAGTTCGAGGTCTTATGG

215

58-60

AJ234881

 

GCATTCTTCCTAACCAGCGC

   

AJ234881

MWG2299

TTGATACCAAAATGGAGTCC

~700

52-55

AJ234883

 

ACGGGATAAAATCCGACC

   

AJ234883

MWG2301

CACATTACAGTACACAGCAACAGC

152

58-60

AJ234887

 

CCACAGTGTTGGGTTGGGAC

   

AJ234887

MWG2303

AAATCATTCTCCGGTCCGC

284

55-58

AJ234889

 

GTCTTTGTTTCTGTGCCTGC

   

AJ234889

MWG2304

AGGCTTCCAGGATTCCACACC

158

55-58

AJ234891

 

CGTCACGCAGTTTGCTCAGG

   

AJ234891

MWG2307

AGACCACGATCTTCCGTCGG

382

60-62

AJ234893

 

TGCATACATGCTCTGACTTGC

   

AJ234893

MWG2309

TAGATGTGTGGGACAGAGGGC

~400

58-60

AJ234894

 

TCAGAGAATCACTGGCGTGC

   

AJ234894

MWG2310

GCGAGCTTCAGCAGGTTCAGG

120

48-50

AJ234895

 

CGACGATGCTTGCGCCTTGG

   

AJ234895

MWG2313

GCCATCAGTCAGAATACATGC

166

58-60

AJ234897

 

ACAGTTGAGCGGACCTGTCC

   

AJ234897

MWG2317

CAGACGAACAGTGGGTTGTGG

99

58-60

GG/MWG2317-5

 

GAAACATAATGGACGGTCAGC

   

GG/MWG2317-5

MWG2318

GACCTGGCACATGGTGTTCAGC

102

60-62

AJ234900

 

TGCGGCTTCCCGTTCTTGTC

   

AJ234900

PBI21

TAATGGCGTGCTATACAGACC

258

55-58

GG/PBI21-3

 

CATGACTAGGCATAATTGGC

   

GG/PBI21-3

PBI35

CTTGGCATCCCAGATAAGGG

297

55-58

GG/PBI35-5

 

CAATCCTCCGGGTCTTTGG

   

GG/PBI35-5

Ris13

AGTTCGTGCGGTTTGGC

182

58-60

GG/RIS13-5

 

AGGTCTCACTCACTACAGCCG

   

GG/RIS13-5

Ris15

TCTACCATGTCAGTCAGCGCC

298

60-62

GG/RIS15-3

 

AGACCGATCTCGATCTCGCC

   

GG/RIS15-3

Ris19

AGGTGCTTCTTCTTCAGCCGC

274

60-62

GG/RIS19-5

 

TGTACCAGTGGAACCGGAACG

   

GG/RIS19-5

Ris44

GCACAAATCCGATCTTTGG

344

55-58

GG/RIS44-3

 

ATCCACTTGCTTCTCCTTCC

   

GG/RIS44-3

Ris45

CCTCAACAGCATGTCTGTGG

578

55-58

GG/RIS45-5

 

TTCCCAGTTTGGTCTACGG

   

GG/RIS45-5

RWTHA157

CCTTTGTGTTCTCCGAACTGC

377

55-58

GG/RWTH57-5

 

AAGCAATTCACCTTGCCGC

   

GG/RWTH57-5

RWTHBE54

GTAAGCTATCTGAATTTCCGC

423

55-58

GG/RWTH54-5

 

CATTGGGCTGACTGTGAACC

   

GG/RWTH54-5

WG0622

CTGCCTGTTGATTTTCCATG

161

58-60

GG/WG622-3

 

TTCACCTTGCCATGACGA

   

GG/WG622-3

Return to GrainGenes Home Page