Allele-Specific Markers within the Barley Stem Rust Resistance Gene (Rpg1)

Peter Eckstein,  Brian Rossnagel, and Graham Scoles

Department of Plant Sciences / Crop Development Centre,

University of Saskatchewan, Saskatoon, SK, Canada,  S7N 5A8

Introduction

The stem rust resistance gene (Rpg1) has provided durable resistance to the fungal pathogen Puccinia graminis f. sp. tritici in barley.  A molecular marker (ABG704) located on chromosome 1 (7H) has previously been identified for this gene by Kleinhofs et al. (1993).  This RFLP probe has been modified to a post-amplification restriction based marker (Kilian et al., 1994), and a sequence characterized amplified region (SCAR) marker (Penner et al., 1995), which are easier to use.  These markers recombine with Rpg1 at less than 1%, but still misidentify a large number of cultivars in our breeding program as “resistant”.  As a result, many of our crosses are marker monomorphic and not amenable to marker-assisted selection.  In addition, the SCAR marker developed by Penner was based on a single nucleotide substitution and the primers are sensitive to amplification conditions. With the recent isolation of Rpg1 (Brueggeman et al., 2002), the possibility existed to construct a diagnostic set of primers based on sequence variation within the gene.  By sequencing the gene from a number of cultivars, the functional form of the resistance gene was characterized. Susceptible cultivars that have altered forms of the gene can be classified into three types based on nucleotide modifications.  In addition, a fourth group of susceptible cultivars appear not to have the gene at all.  Brueggeman et al. (2002) identified a 3bp insertion (GTT) at amino acid position 320 of Rpg1 that resulted in a serine to arginine conversion and an adjacent insertion of a phenylalanine residue.  This insertion was absent in the resistance allele but common to the susceptibility alleles of groups 1, 2, and 3.  We have developed robust, allele specific SCAR markers based on this 3bp insertion/deletion that differentiate between the resistance allele, and group 1-4 susceptibility alleles.

Materials and Methods

Resistance Reaction (RPG1-R); primer RPG1RF (CGGCTAATCACATCAAGTAA) was designed to specifically anneal to the resistance allele nucleotide sequence, not including, but stradling the 3 bp insertion (Fig.1).  The reverse primer RPG1RR (TTCTCCATTGTCCAACCTC) anneals to both alleles.

Susceptibility Reaction (RPG1-S); primer RPG1SF (GGCTAATCACATCAAGGTT) was designed to specifically anneal to the susceptibility allele nucleotide sequence, including the 3 bp insertion at the 3’ end (Fig.1). The reverse primer RPG1SR (CCACGACCAA TTATGTTCTG) is also specific to the susceptibility allele based on an A/C substitution.

The reverse primers of the two primer sets were designed to anneal at positions such that the bands produced would not be the same size.

PCR conditions; reaction and cycling parameters are similar for both RPG1-R and RPG1-S.  Reactions (25μL) consist of 20mM Tris-HCL pH 8.4, 50mM KCl, 2.0mM MgCl₂,200mM dNTP, 200nM each primer, 1 unit polymerase, and 100ng template DNA.  Cycling conditions;  94°C (30 sec.), anneal (45 sec.), 72°C (60 sec.), 35 cycles,  with an extended initial denaturation time.   

Results and Discussion

The resistant reaction (RPG1-R) produces a single band of 610bp in coupling with resistance (Fig.2A).  The primers selectively amplify the resistance allele over an annealing temperature range from 51°C to 66°C.  The susceptible reaction (RPG1-S) produces a single band of 487bp in coupling with susceptibility allele types 1-3, but does not amplify the type 4 allele (Fig.2B).  The annealing temperature range within which the primers selectively amplify the desired allele is 52°C to 64°C.  Both reactions are robust, and “negative” reactions are clearly negative without "ghost" banding.  The wide effective range of annealing temperatures enhances the  potential for multiplexing with other markers.

Markers RPG1-R and RPG1-S can be multiplexed at an annealing temperature of 63°C to produce a co-dominant test, eliminating false negative results. The multiplex reaction is effective when screening resistant cultivars, and susceptible cultivars of types 1-3, as illustrated in Figure 2C.  The forward and reverse primers of the resistance reaction produce a single band of 610bp in resistant lines.  The selective susceptibility reaction primer (RPG1SF) combines with RPG1SR to amplify the 487bp fragment, and combines with the non-selective primer RPG1RR from the resistance reaction to produce the 610bp band.  Neither set of primers produce a band from type 4 susceptible cultivars as these do not carry the gene. 

Since both markers are situated within the gene and are based on nucleotide changes that render the gene functional/non-functional, the markers can be used to screen uncharacterized lines for the presence of Rpg1.  Of 42 cultivars tested (Table 1), the disease ratings and marker indicated genotypes of 41 cultivars correspond, while one cultivar that is considered resistant (Maud) is putatively misclassified by the markers as being susceptible (type 4).  Since the disease reaction data from this cultivar is based on limited testing, the phenotype of the cultivar may be questionable.  If indeed Maud is resistant, the negative RPG1-R and RPG1-S results may be due to nucleotide changes within the priming regions that do not alter the amino acid sequence of the functional protein, or nucleotide changes that result in an isoform of the protein which retains its function.  Alternatively, the cultivar may lack a functional Rpg1 and carry a different source of resistance to stem rust. 

One such source of resistance could be the Rpg1 gene from OSU6, a H. vulgare subsp.  spontaneum line, which was identified by Brueggemann as being resistant despite the fact that the gene has the three base insertion that is common to the susceptible lines/cultivars.  The present markers indicate OSU6 to be susceptible and any lines/cultivars that have inherited the resistance from OSU6 would also be wrongly classified.  While this possibility exists, the markers were designed to take advantage of the 3bp insertion/deletion since this site was common across all of the susceptibility alleles, and provided the opportunity for the most robust set of primers.  Additionally, few cultivars likely carry the OSU6 version of the gene.

While there are no instances of the markers identifying a susceptible cultivar as resistant, this may occur as more cultivars are screened, possibly as a result of nucleotide changes within Rpg1 other than those identified by Brueggemann.  These changes could render the gene inactive, yet the markers would indicate a functional version of the gene. 

Table 1.  Stem rust resistance (Rpg1) phenotypes and marker (RPG1-R, RPG1-S) indicated genotypes of barley.  Cultivars in which the markers do not correctly identify the phenotype are marked with an asterisk.

Figure 1. Partial sequence of Rpg1 (Brueggeman et al., 2002) starting at exon 6, illustrating the 3bp insertion in DNA of susceptible cultivars, and the selective primers (RPG1RF, RPG1SF) of the allele specific SCAR markers.

Figure 2. Marker banding patterns from allele specific SCAR markers on cultivars Morex, Q21861, and TR306 (all resistant), Steptoe (type 1 susceptible), SM89010 (type 2 susceptible), and Harrington (type 4 susceptible). A) RPG1-R marker.  B) RPG1-S marker.  C) RPG1-R and RPG1-S combined. 

Acknowledgments  

We thank Tom Fetch and Bill Legge for stem rust resistance phenotype information.  The work was supported with funds from the Western Grains Research Foundation.

References

Brueggeman, R., N. Rostoks, D. Kudrna, A. Kilian, F. Han, J. Chen, A. Druka, B. Steffenson, and A. Kleinhofs.  2002.  The barley stem-rust resistance gene Rpg1 is a novel disease-resistance gene with homology to receptor kinases.  Proc. Natl. Acad. Sci. USA 99:9328-9333.

Kilian, A., B.J. Steffenson, M.A. Saghai Maroof, and A. Kleinhofs.  1994.  RFLP markers linked to the durable stem rust resistance gene Rpg1 in barley.  Molec. Plant-Microbe Inter. 7:298-301.

Kleinhofs, A., A. Kilian, M.A. Saghai Maroof, R.M. Biyashev, P. Hayes, F.Q. Chen, N. Lapitan, A. Fenwick, T.K. Blake, V. Kanazin, E. Ananiev, L. Dahleen, D. Kudrna, J. Bollinger, S.J. Knapp, B. Liu, M. Sorrells, M. Heun, J.D. Franckowiak, D. Hoffman, R. Skadsen, and B.J. Steffenson.   1993.  A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genome.  Theor. Appl. Genet. 86:705-712.

Penner, G.A., J. Stebbing, and B. Legge.  1995.  Conversion of an RFLP marker for the barley stem rust resistance gene Rpg1 to a specific PCR-amplifiable polymorphism.  Molecular Breeding 1:349-354.