Title

Barley Genetics Newsletter 36:30-43 (2006)

 

 

New SSR markers for barley derived from the EST database

 

Karen A. Beaubien and Kevin P. Smith*

Department of Agronomy and Plant Genetics, University of Minnesota, St. Paul, MN

*Corresponding author: E-mail: smith376@umn.edu

 

Introduction

            There are currently 1,196 microsatellite [or simple sequence repeat (SSR)] marker primer sets that have been developed for barley (from both genomic libraries and EST databases) of which 504 have been mapped (Saghai Maroof et al., 1994; Becker and Heun, 1995; Liu et al., 1996; Struss and Plieske, 1998; Ramsay et al., 2000; Pillen et al., 2000; Holton et al., 2002; Thiel et al., 2003; Li et al., 2003; Yu et al., 2005).  Unfortunately, the available SSR markers provide uneven coverage of the barley genome and are concentrated near the centromeres.  We have compared the available mapped SSRs and identified 62 BINs out of the total of 99 barley BINs (http://barleygenomics.wsu.edu/; http://rye.pw.usda.gov/cgi-bin/gbrowse/BarleyBinMaps) that have poor coverage.  Although this represents, 63% of the barley genome, only 31% of the available SSRs map to these BINs.  Additional SSR markers are needed to increase coverage in these BINs.  Moreover, some of the SSR markers recently published are restricted from being used to develop new barley varieties, thus there is still a need for additional publicly available SSR markers that can be used without restrictions.

 

Materials and Methods

            Barley ESTs used for primer development were selected by using either rice BAC or wheat EST sequences in a BLASTn search for publicly available barley ESTs with the low complexity filter turned off (BLASTn searches were completed between October, 2002 and October, 2004) (http://www.ncbi.nih.gov/BLAST/).  Matches with e-values between 0 and 1e-2 were used.  The resulting barley ESTs were processed through the Tandem repeats finder which measures the rate at which the actual EST sequence matches a perfect repeat sequence (Benson, 1999; http://tandem.bu.edu/trf/trf.submit.options.html).  Primers were designed for SSRs with 85-100% matches to the perfect repeat sequence.  Primer pairs were designed to flank SSR motifs using Primer3 software (Rozen and Skaletsky, 2000; http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and screened on a set of mapping parents to identify which population(s) were appropriate for mapping.  Primer pairs were tested using two to four PCR protocols to identify a protocol that resulted in clear products (Tables 1 and 2).  Products were separated on 6% polyacrylamide gels and visualized using silver staining.

            Newly developed SSR markers were mapped on the appropriate mapping population(s)   including: Steptoe x Morex (Kleinhofs et al., 1993), Chevron x M69 (Canci et al., 2003), Frederickson x Stander (Mesfin et al., 2003), or Atahualpa x M81 (unpublished).  We used JoinMap 3.0 for map construction (Van Ooijen and Voorrips, 2001).  Assignment to BINs was based on adjacent mapped markers that have been previously assigned to BINs (http://barleygenomics.wsu.edu/; http://rye.pw.usda.gov/cgi-bin/gbrowse/BarleyBinMaps).  Wheat STS markers were mapped on the barley populations to increase the coverage of chromosome 3 (3H) (Liu and Anderson, 2003).    

Results and Discussion

            A total of 76 new markers were developed that produce between two to six alleles per locus among the twelve mapping parents: Atahualpa, M81, Chevron, M69, Frederickson, Stander, Harrington, OUH602, Hor211, Lacey, Steptoe and Morex (Table 3).  Sixty of the markers were mapped using the Steptoe x Morex, Chevron x M69, Frederickson x Stander, and Atahualpa x M81populations (Figure 1 and Table 3).  Of the 60 mapped markers, 41 (68%) have mapped to BIN positions that were previously identified as being poorly covered with the currently available SSR markers.  These markers should provide additional tools for barley genetic mapping and marker-assisted selection.

 

Acknowledgements

The authors would like to thank Charles Gustus and Danielle Wojdyla for their assistance in STS and SSR marker data collection.  This work was carried out in part using software provided by the University of Minnesota Supercomputing Center.  This research was supported by U. S. Barley Genome Project.

 

References:

 

Becker, J., and M. Heun.  1995.  Barley microsatellites: allele variation and mapping.  Plant Mol. Biol. 27: 835-845.

Benson, G.  1999.  Tandem repeats finder: a program to analyze DNA sequences.  Nucleic Acids Research 27: 573-580.

Canci, P.C., L.M. Nduulu, R. Dill-Macky, G.J. Muehlbauer, D.C. Rasmusson, and K.P. Smith.  2003.  Genetic relationship between kernel discoloration and grain protein concentration in barley.  Crop Sci. 43: 1671-1679.

Holton, T.A., J.T. Christopher, L. McClure, N. Harker, and R.J. Henry.  2002.  Identification and mapping of polymorphic SSr markers from expressed gene sequences of barley and wheat.  Mol. Breeding 9: 63-71. 

Kleinhofs, A., A. Kilian, M.A. Saghai Maroof, R.M. Biyashev, P. Hayes, F.Q. Chen, N. Lapitan, A. Fenwick, T.K. Blake, V. Kanazin, E. Ananiev, L. Dahleen, D. Kudrna, J. Bollinger, S.J. Knapp, B. Liu, M. Sorrells, M. Heun, J.D. Franckowiak, D. Hoffman, R. Skadsen, and B.J. Steffenson.  1993.  A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genome.  Theor. Appl. Genet. 86: 705-712.

Li , J.Z., T.G. Sjakste, M.S. Röder and M.W. Ganal.  2003.  Development and genetic mapping of 127 new microsatellite markers in barley.  Theor. Appl. Genet. 107: 1021–1027.

Liu, S., and J.A. Anderson.  2003.  Targeted molecular mapping of a major wheat QTL for Fusarium head blight resistance using wheat ESTs and synteny with rice.  Genome 46: 817-823.

Liu, Z.-W., R.M. Biyashev and M.A. Saghai Maroof.  1996.  Development of simple sequence repeat markers and their integration into a barley linkage map. Theor. Appl. Genet. 93: 869–876.

Mesfin, A., K.P. Smith, R. Dill-Macky, C.K. Evans, R Waugh, C.D. Gustus, and G.J. Muehlbauer.  2003.  Quantitative trait loci for Fusarium head blight resistance in barley detected in a two-rowed by six-rowed population.  Crop Sci. 43: 307-318.

Pillen, K., A. Binder, B. Kreuzkam, L. Ramsay, R. Waugh, J. Förster, J. Léon.  2000.  Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars.  Theor. Appl. Genet. 101: 652-660.

Ramsay, L., M. Macaulay, S. degli Ivanissevich, K. MacLean, L. Cardle, J. Fuller, K. J. Edwards, S. Tuvesson, M. Morgante, A. Massari, E. Maestri, N. Marmiroli, T. Sjakste, M. Ganal, W. Powell, and R. Waugh.  2000.  A Simple Sequence Repeat-Based Linkage Map of Barley.  Genetics 156: 1997-2005.

Rozen, S., and H. Skaletsky.  2000.  Primer3 on the WWW for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology. Eds Krawetz, S., and Misener, S.  Humana. Totowa, NJ.  pp 365-386.

Saghai Maroof, M.A., R.M. Biyashev, G.P. Yang, Q. Zhang and R.W. Allard.  1994.  Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations and population dynamics. Proc. Natl. Acad. Sci. USA 91: 5466–5470.

Struss, D., and J. Plieske.  1998.  The use of microsatellite markers for detection of genetic diversity in barley populations.  Theor.  Appl.  Genet. 97: 308-15.

Thiel, T, W. Michalek, R.K. Varshney, and A. Graner.  2003.  Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.).  Theor. Appl. Genet. 106: 411–422.

Van Ooijen, J.W., and R.E. Voorrips.  2001.  JoinMap 3.0, Software for the calculation of genetic linkage maps.  Plant Research International, Wageningen, the Netherlands.

 

 


 

 

                         Table 1. PCR recipes for UMB SSR markers

PCR recipe

A

B

C

dNTPs (1.25 mM each)

1.0

1.0

1.0

MgCl22 (25 mM)

1.0

1.0

0.5

10 X buffer *

1.0

1.0

1.0

Forward Primer (5μM)

0.6

0.6

1.0

Reverse Primer (5μM)

0.6

0.6

1.0

Betaine (5 M)

0

2.0

0

DMSO (100%)

0

0.5

0

Taq polymerase*

0.075

0.075

0.075

H2O

2.725

0.225

2.425

DNA (10 ng/μL)

3.0

3.0

3.0

Total

10.0

10.0

10.0

                         * 10 X buffer is provided with purchase of Taq polymerase

 

 

    Table 2.  PCR programs for UMB SSR markers

Stage

Temp. (°C)

Time (min.)

Cycles

Stage

Temp. (°C)

Time (min.)

Cycles

 

 

Program A*

Program F*

Initial Hold

95

9:00

1

Initial Hold

-

-

-

Thermal Cycles-1

94

1:00

 

18

 

Pre-PCR

95

9:00

 

1

 

64

0:30

58

1:00

72

1:00

72

1:00

Thermal Cycles-2

94

1:00

 

30

 

Thermal Cycles

94

0:30

 

30

 

55

1:00

58

0:30

72

1:00

72

0:30

Ending Hold

72

5:00

1

Ending Hold

72

5:00

1

Final Hold

4

1

Final Hold

4

1

 

 

 

 

 

 

 

 

Program J*

Program L58

Initial Hold

95

8:00

1

Initial Hold

95

9:00

1

Thermal Cycles

94

1:00

 

35

 

Thermal Cycles

94

0:10

 

30

 

60

1:00

58

0:20

72

2:00

72

0:45

Ending Hold

72

5:00

1

Ending Hold

72

2:30

1

Final Hold

4

1

Final Hold

4

1

    * Programs A, F and J are as in Ramsay et al., 2000. 


Table 3.  PCR and mapping information for UMB markers.

 

 

 

Population2

Quality

 

PCR

PCR

Name

Chr.

BIN1

Polymorphism

Mapped

Score3

Alleles4

Program

Recipe

UMB101

1 (7H)

11-12

A/M; F/S; H/O; H/L; S/M

A/M; F/S; S/M

2

3

L58

A

UMB102

1 (7H)

11-12

A/M; H/O; H/L; S/M

S/M

2.5

2

L58

A

UMB103

1 (7H)

13

A/M; F/S; H/O; H/L; S/M

A/M; F/S; S/M

2

4

L58

A

UMB104

1 (7H)

7-8

C/M; F/S; H/O; H/L; S/M

F/S; S/M

1.5

2

F

A

UMB105

1 (7H)

10-11

A/M; C/M; H/O

A/M; C/M

3

2

L58

A

UMB106

1 (7H)

4-5

C/M; H/L; S/M

C/M; S/M

2

2

L58

A

UMB107

1 (7H)

4-5

F/S; H/O

F/S

3

4

J

C

UMB108

1 (7H)

2

A/M; F/S; H/O; H/L; S/M

F/S; S/M

1

3

A

B

UMB201

2 (2H)

6-7

C/M; F/S; H/O; H/L; S/M

C/M; F/S; S/M

2.5

4

L58

A

UMB202

2 (2H)

6-7

A/M; C/M; F/S; H/O; S/M

A/M; C/M; F/S; S/M

2

2

F

A

UMB203

2 (2H)

4-5

C/M; H/L

C/M

2

2

J

C

UMB204

2 (2H)

7-8

F/S; H/O

F/S

2.5

2

L58

A

UMB205a

2 (2H)

4-5

C/M

C/M

1

2

J

C

UMB205b

2 (2H)

4-5

A/M; C/M; H/O

C/M

1

3

J

C

UMB206

2 (2H)

2-3

C/M; F/S; H/O; H/L; S/M

F/S; S/M

2

3

L58

B

UMB301

3 (3H)

1-2

C/M; F/S; H/L; S/M

C/M; F/S; S/M

3

3

F

A

UMB302

3 (3H)

4-6

A/M; C/M; F/S; H/O; S/M

A/M; C/M; F/S; S/M

1

4

L58

A

UMB303

3 (3H)

4-6

A/M; C/M; F/S; H/O; S/M

A/M; C/M; F/S; S/M

2

6

L58

A

UMB304

3 (3H)

4-6

A/M; C/M; F/S; H/L; S/M

A/M; C/M; S/M

1

4

J

C

UMB305

3 (3H)

2-4

A/M; H/O; H/L

A/M

1

2

F

A

UMB306

3 (3H)

2-4

A/M; H/O; H/L

A/M

1

3

F

A

UMB307

3 (3H)

2-4

A/M; H/O; H/L

A/M

1

3

L58

A

UMB308

3 (3H)

1-2

A/M; C/M; F/S; H/O; S/M

F/S; S/M

2.5

2

F

B

UMB309

3 (3H)

4-6

A/M; C/M; F/S; S/M

S/M

3

4

J

B

UMB310

3 (3H)

4-6

A/M; C/M; F/S; H/L; S/M

C/M; S/M

2

3

L58

B

UMB311

3 (3H)

16

CM; F/S; H/L

C/M

3

3

J

B

UMB401

4 (4H)

4-5

H/O; H/L; S/M

S/M

1

2

J

B

UMB402

4 (4H)

2-3

H/O; H/L; S/M

S/M

1

2

L58

A

 

Table 3 cont. PCR and mapping information for UMB markers.

 

 

 

Population2

Quality

 

PCR

PCR

Name

Chr.

BIN1

Polymorphism

Mapped

Score3

Alleles4

Program

Recipe

UMB403

4 (4H)

4-5

A/M; C/M; H/O; H/L; S/M

C/M; S/M

2

4

L58

B

UMB404

4 (4H)

5-6

C/M; H/O; S/M

C/M; S/M

1

2

J

B

UMB501a

5 (1H)

6

C/M; F/S

C/M; F/S

2

2

L58

B

UMB501b

5 (1H)

6

C/M; F/S

C/M; F/S

3

2

L58

A

UMB502

5 (1H)

12-13

A/M; F/S; H/O

A/M; F/S

1

3

L58

A

UMB503

5 (1H)

2

A/M; C/M; F/S; H/O; H/L; S/M

C/M; S/M

2

6

L58

A

UMB504

5 (1H)

11-12

A/M; F/S; H/O; H/L; S/M

F/S; S/M

2

4

L58

B

UMB505

5 (1H)

2

A/M; C/M; H/O; H/L; S/M

S/M

3

3

J

B

UMB506

5 (1H)

6

C/M; F/S; H/O; H/L

C/M; F/S

2

2

J

B

UMB507

5 (1H)

6

C/M; F/S; H/O; H/L

C/M; F/S

1

3

L58

B

UMB508

5 (1H)

14

A/M; C/M; F/S; H/O; H/L

C/M

2.5

3

L58

B

UMB601

6 (6H)

13-14

A/M; F/S; S/M

A/M; F/S; S/M

1

2

F

B

UMB602

6 (6H)

11-13

A/M; C/M; F/S; H/O; H/L

A/M; C/M; F/S

2

4

F

A

UMB603

6 (6H)

13-14

A/M; C/M; F/S; H/O; H/L; S/M

A/M; C/M; F/S; S/M

2

4

L58

A

UMB604

6 (6H)

7-9

A/M; C/M; F/S; H/O; H/L; S/M

C/M; F/S; S/M

1

5

L58

A

UMB605

6 (6H)

14

A/M; C/M; F/S; H/O; H/L

C/M; F/S

1

2

L58

B

UMB606

6(6H)

1

A/M; C/M; F/S; H/O; H/L; S/M

S/M

3

3

F

B

UMB701

7 (5H)

9

A/M; F/S; H/O

F/S

2

2

J

B

UMB702

7 (5H)

10-11

C/M; H/O; H/L

C/M

1

3

F

A

UMB703

7 (5H)

7-8

A/M; S/M

S/M

1.5

2

L58

A

UMB704

7 (5H)

2-4

A/M; F/S; H/O; H/L

A/M; F/S

1

4

L58

A

UMB705

7 (5H)

5-6

F/S; H/O

F/S

1.5

3

L58

A

UMB706

7 (5H)

9

A/M; C/M; H/O; H/L

A/M; C/M

1

2

L58

A

UMB707

7 (5H)

6-7

A/M; F/S; H/O; S/M

A/M; S/M

1

3

L58

A

UMB708

7 (5H)

10-11

A/M; H/O

A/M

1

2

F

A

UMB709

7 (5H)

10-11

 

A/M; H/O; S/M

S/M

2

2

F

UMB710

7 (5H)

11-12

 

S/M

S/M

2

2

L58

UMB711

7 (5H)

11-12

 

A/M; F/S; H/O; H/L; S/M

F/S; S/M

2

3

L58

 

Table 3 cont. PCR and mapping information for UMB markers.

 

 

 

 

Population2

Quality

 

PCR

PCR

Name

Chr.

BIN1

 

Polymorphism

Mapped

Score3

Alleles4

Program

Recipe

UMB712

7 (5H)

13-14

 

A/M; F/S; H/O; H/L; S/M

F/S; S/M

2

3

F

B

UMB713

7 (5H)

13-14

 

A/M; F/S; H/O; S/M

S/M

2

4

L58

B

UMB714

7 (5H)

13-14

 

A/M; F/S; H/O; H/L; S/M

F/S

3

2

F

B

UMB715

7 (5H)

13

 

A/M; F/S; H/O

F/S

2

5

J

B

UMB001

 

 

 

H/L

 

2

3

L58

B

UMB002

 

 

 

H/O

 

3

2

F

A

UMB003

 

 

 

H/O

 

2

4

F

A

UMB004

 

 

 

H/O; H/L

 

3

2

J

C

UMB005

 

 

 

H/O

 

1.5

2

L58

A

UMB006

 

 

 

H/O

 

3

2

L58

A

UMB007

 

 

 

H/O; H/L

 

2

3

L58

A

UMB008

 

 

 

H/O; H/L

 

1

3

A

C

UMB009

 

 

 

H/O

 

2

3

L58

A

UMB010

 

 

 

A/M; H/O; H/L; S/M

 

2.5

3

F

A

UMB011

 

 

 

A/M; H/O

 

1

3

L58

B

UMB012

 

 

 

H/O

 

1

2

L58

B

UMB013

 

 

 

H/L

 

2

2

L58

B

UMB014

 

 

 

A/M; C/M; H/O; H/L

 

2

3

J

B

UMB015

 

 

 

C/M; H/O; H/L; S/M

 

3

5

F

B

UMB016

 

 

 

H/O

 

1

2

A

B

1 Bold type indicates BINs with poor SSR marker coverage

2 Mapping populations: A/M=Atahualpa x M81; C/M=Chevron x M69; F/S=Frederickson x Stander;

                                       H/O=Harrington x OUH602; H/L=Hor211 x Lacey; S/M=Steptoe x Morex

3 Scale from 1-5 where 1=Very easy to score and 5=Very hard to score

4 Number of Alleles based on the twelve mapping parents

 

 

 

           

           


 Table 4. Design information for UMB primers.

 

EST

Forward

Reverse

Name

Accession1

Primer

Primer

UMB101

BE421034

CGGGTTCCATTGAGAAGAAC

CACAAATACAGATGCCGCAC

UMB102

CB881209

TTGTGTTTGAGATATCCTGTACTTTTC

ACCTTTTGCCGGCTTTTATT

UMB103

BQ762328

TGCCCATGAAGCCTCTTTAC

GGAACGGAGGGAGTATTAAGC

UMB104

CB881555

GGAAAAATAAACTATTCAACATCCTG

CAGCGCATGTGTTCTCAGAT

UMB105

BJ485220

GCCCCTGGTAAGAACTCCAT

CTGGGAACCGTACAGTGTTG

UMB106

AL502019

AGCATAAAGCCGCAAAAGAA

GCGTCCTGATGAAGAGGTGT

UMB107

CB873957

ACGCACGGGCATTTGTACT

GCCTGCATCATTTGTTTGTG

UMB108

CV055381

TCAAGCTGCTGCATTGCT

AGCCCAAACCCTTTTGTTTT

UMB201

BJ480735

GCTCCTGAAAAGGACCTCAG

TCTCCGCCACCTACACATAG

UMB202

BG299528

GGTCGGCTCCCTCTTCTACT

CGAGCGACATGAGGAACAT

UMB203

CB873608

TTTCATTGCTGTGACGGATG

AGCCTCACCCGGACTACC

UMB204

BM371159

GAATCCTCGGCCTTCTCAAC

GCGGAGCTTGACCTCGAC

UMB205a

CB881957

CGGTCGTAGAACGGAATCAG

GCACTTCCACCACAAGAAGC

UMB205b

CB881957

CGGTCGTAGAACGGAATCAG

GCACTTCCACCACAAGAAGC

UMB206

CB863325

GCGCTAGCTATCCACACAAA

AACATTAAGGGCGACAAGGA

UMB301

AV944239

CTTCACATGTCTGGGAAAACA

GACATGTTGGAAGGTGGCTT

UMB302

CD663662

ACCACAGGTAACCTCGCAAC

AAAGTGCTGGGAGCTTGAAA

UMB303

BU979287

CACGAGGGATGCTCTTGAGT

TGTATATTTCAAGCTCCCAGCA

UMB304

BM443659

CTTCGCTTACCGCTTTCG

TTTCAAGCTCCCAGCACTTT

UMB305

BJ484842

CAGAGCGGGCTCAACGTA

ACTTGCTGTCATCCTTGCTG

UMB306

BJ467519

GCAGAGCTGGCTCAACGTA

TTCACTGATCGACCACTTGC

UMB307

BJ461914

CTGCAGAGCTGGCTAACGTA

TTCACTGATCGACCACTTGC

UMB308

CB859861

CCCCTCAGGTTGTTCATCAT

AGCAGCAGCAACAACAACAG

UMB309

BF265771

GCTCGACTTCGAGGACACC

ATTCTTGCGGAACGACCTC

UMB310

CB879994

CTCCCAGCACTTTCACCATC

CCGATGCTCTTGAGTCGTG

UMB311

CA592691

ATCCAGTTTCAGCCACCAAC

ACCGCAGTGATCAGTGACAA

UMB401

AL507067

CGTCTTCGTACTCGCCTCTC

ATCGAGATGCACTCCCTCAT

UMB402

BQ466542

TCGATCCATCCAAACATGAG

CGTGTCACGTGTGTGTGTGT

 

             Table 4 cont. Ordering and design information for UMB primers.

 

EST

Forward

Reverse

Name

Accession1

Primer

Primer

UMB403

BM372825

TTCCGCAGATTCATTTCCAC

GCTGGACAGGCGTTAAAAAG

UMB404

AJ475924

GGAGGCAAGAACACTTGACAG

GCTCGATCTCCTCCTTGTTG

UMB501a

BE421033

CACACAGGCGACCATTTTC

CAGCTAGACGCTATGAGCCA

UMB501b

BE421033

CACACAGGCGACCATTTTC

CAGCTAGACGCTATGAGCCA

UMB502

BI953342

ATCCCATCTCCCTCCTCCTA

TGGAGTGCTCCTCCCAGTAG

UMB503

BQ766039

TCCCGGTGCCATATACAAAT

TTTGATGAAACGAAGGGAAA

UMB504

CV054443

CAAAGTGCGCGTGAGAAATA

AATCACCACCAGCTTCTTGG

UMB505

BE195848

ATGTTGCAGCAGAGCAGTTG

ATTGTTGGGGTTGTTCTTGC

UMB506

CD663377

CTCTTCCGTGAAACGAAACC

CGAGCAAGGACGTGGTAGAT

UMB507

CD663377

ATGTTTCAACAGGCCATTCC

CATGAAAACAGATGACGATGC

UMB508

BF621983

GATTAAGGCGTCCAATTCCA

TCGGGATGTGAAGAAGGAAC

UMB601

BJ486149

AAATACCGTATGGAGGGTGCT

CTACCCCTACGTCCGAGATG

UMB602

CB877685

AGGAGTGGGTCTCAGGTTTG

CAAGCAGATGCAACTACACCA

UMB603

CA006980

ATGAAACATCGCGAACTGTG

ACTGCAGTGAGGGAAGCTGT

UMB604

CA004840

GAGCAATCCCCTCATCCAAT

TCTTTGGTTTCCTCGTGTCC

UMB605

CD053629

GAGGCTTGTTCCTCAGACCA

ATGAGGAAGAGCGGGATCAG

UMB606

CV056304

CGAGCAGCAGCAGATCGT

CTCCTGCGCTTGGAGAAG

UMB701

BE421177

ACGTCGTGGATCAACGTGTA

TTACATTGCGCACAGCTAGG

UMB702

BF265777

CAGCATCCATCAGCAATGAA

CATGTTTGGCTTCTTCGTCC

UMB703

CA025623

GCCGCCTCTTACTCTTTGC

GGAGATGCCGAGGGACTT

UMB704

AV942720

ATCCTCCAACGAGGCACATA

GAGTCCATTTCACGGAGACC

UMB705

CB876579

TGCTGAGACACACACACACC

CGATGCACGAAAAGCTGTAG

UMB706

CB875298

TCAACAGATGACGTGCATGA

TCACACATTGAGGGAGGACA

UMB707

CB876579

TGCTGAGACACACACACACC

CGATGCACGAAAAGCTGTAG

UMB708

BE421505

CTCCTCAGCTCTGGAATGGA

GCGCATATACAAGCCAAACA

UMB709

CV063649

ACGACAAGACTATGGCAGCA

AAGGTTTCCTCAGCCTGTGA

UMB710

CV063745

ACAGTTCCCAACTTCCAAGC

CAGCACATCAGCCCGTACT

UMB711

BJ553047

GCAACGACACGTCTAAACCA

GTGGTGTGGTGTCCTTCCTC

           

              Table 4 cont. Design information for UMB primers.

 

EST

Forward

Reverse

Name

Accession1

Primer

Primer

UMB712

CB881537

CAAGAAGGAACGAAGCCAAG

TGCTAGTTTTTCCGGCTGAT

UMB713

CB881537

ATCAGCCGGAAAAACTAGCA

CAAGCGAAGAGGAAGAGGAA

UMB714

CB881537

GCAAGCAAATCACACTCTGG

GCGTCATCTACGGCTGATTC

UMB715

CB879524

CCGCGCCTAATTAACAAAAA

AGCTGACTGCTGACCAACCT

UMB001

BI949870

TTCTCCATGTTCGGCTTCTT

ATCAGCAATGAAGTTGTCGG

UMB002

BJ481660

GGCAAGTGAGCTCAACCTCT

GCCCTCACATGCAACATCTA

UMB003

CB881957

TCAGTGGTGACCGTGGTATC

GCACTTCCACCACAAGAAGC

UMB004

BG309433

ACCACGTCCACCACCATC

CTCTTTCTCCGCTCATCACC

UMB005

BQ763410

AAGAAAGCCCGGAAGAGAAG

ATGGTGCCATCCTGATTGAT

UMB006

BQ662872

CGGAGTCGCTTTCGAGATT

ACTGACAGCAACGGTGGTAG

UMB007

CB881851

CGCAATAAAATCGCAGGAAT

ACGGAAGACCGGGATAGTTT

UMB008

BU996005

CTGGAGCCTAGCTTGGAGTG

CTCCACCGTTCTTCACGTTT

UMB009

BI954579

CATCCCCATCCAGATCCA

GTCGAGAGGTGCGAGGATT

UMB010

BF621983

GCCACAGCCAAGAAAGCTAC

GATGGGATCTGCTTGGAGAG

UMB011

AV918630

TCTTCTCGCTAGCATCAGCA

CAAAGAAGGAGGTGGCTTCA

UMB012

BI960225

ATAGCGACGTGCTCCAGAGA

AGCAGCGACTTCCTTAGCAG

UMB013

CB873614

GAGCAAGCACGCACGTATTA

GGGACCTCGAGATGATCAAG

UMB014

CB882192

CAGGAGATCCGCGCTCTT

CGAGCAGTGAACGATGTACG

UMB015

CA030737

CGGACGAGGTTTACTCCAAA

AGCACAGGAGGATGAGGATG

UMB016

CA032410

CCATCACCCATTTCTTCCTC

GATGGATTTGTCCGTCCAAG

                1 EST accession from which the primers were designed (http://www.ncbi.nih.gov/)

 

Figure 1.  Map locations of the UMB markers on consensus maps of the Steptoe x Morex (S/M), Frederickson x Stander (F/S) and Chevron x M69 (C/M) populations.  Chromosome 7 (5H) is presented as a consensus map of the F/S and C/M populations with the S/M population separate.  UMB508 (denoted with 'Ş') has had its location inferred from the C/M population (C/M is included in the consensus but the inferred marker did not map in the consensus).  Markers denoted with 'u' have had their location inferred from the Atahualpa x M81 (A/M) population.  Marker "ABG497D" [chr. 1 (7H), BIN 11], was named "ABG497B" in Canci et al. (2003), but the "ABG497B" locus should map to chr. 1 (7H), BIN 4, therefore we have designated a new locus name.