Query (optional)   in Class  

GrainGenes Marker Report: BARC204

[Submit comment/correction]

Probe
BARC204
Locus
Xbarc204.1-6A
[ Show all 9 ]
Remarks
Contains motif : (ATT)15
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' CGCAGAAGAAAAACCTCGCAGAAAAACC 3'
5' CGCAGTGTATCCAAATGGGCAAGC 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211643
Source Species
Triticum aestivum
Data Source
Ward, Rick



Locus for Probe
barc204
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 6A88.7
Wheat, Yr genes and QTL 6A48.5
Wheat, Yr genes and QTL 6D52.8
[ Show Nearby Loci ]
Map Data
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Probe
BARC204
Possible Orthologs
Xbarc204
[ Show all 8 ]



Locus for Probe
barc204-6A
Type
Microsatellite
Map
Wheat_AB, Kofa x UC1113 6A31.5
Wheat_AB_2015_Consensus-6A88.7
Wheat_Yr_2021-6A136.85
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Wheat_AB, Kofa x UC1113
Wheat_AB_2015_Consensus
Probe
BARC204
Possible Orthologs
Xbarc204
[ Show all 8 ]



Locus for Probe
Xbarc204
Type
Microsatellite
Chromosome
6D
Map
Ta-NxW-6D135.4
Wheat-Composite2004-6D102
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Wheat, Nanda2419 x Wangshuibai
Probe
BARC204
Possible Orthologs
Xbarc204-1A
[ Show all 8 ]



Locus for Probe
Xbarc204-1A
Type
Microsatellite
Map
T.b.xT.m.-1A69.2
[ Show Nearby Loci ]
Map Data
T. boeoticum x monococcum
Probe
BARC204
Possible Orthologs
Xbarc204
[ Show all 8 ]



Locus for Probe
Xbarc204-6A
Type
Microsatellite
Chromosome
6A
Map
Chinese_Spring_Deletion_SSR_6A0.95
Kofa/UC1113-6A67.1
Ta-Synthetic/Opata-BARC-6A74.4
[ Show Nearby Loci ]
Breakpoint Interval
6AL8-0.90-1.00
Map Data
Durum wheat, Kofa x UC1113
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC204
Possible Orthologs
Xbarc204
[ Show all 8 ]



Locus for Probe
Xbarc204-6D
Type
Microsatellite
Chromosome
6D
Map
Chinese_Spring_Deletion_SSR_6D0.645
Ta-SSR-2004-6D72.8
Ta-Synthetic/Opata-BARC-6D73.5
[ Show Nearby Loci ]
Breakpoint Interval
6DL6-0.29-1.00*
Map Data
Wheat, Consensus SSR, 2004
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC204
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc204
[ Show all 8 ]



Locus for Probe
Xbarc204.1
Type
Microsatellite
Chromosome
6A
Map
Wheat-Composite2004-6A98
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
BARC204
Possible Orthologs
Xbarc204
[ Show all 8 ]



Locus for Probe
Xbarc204.1-6A
Type
Microsatellite
Map
Conan/Reeder-6A3.75645
[ Show Nearby Loci ]
Map Data
Wheat, Conan x Reeder
Probe
BARC204
Possible Orthologs
Xbarc204
[ Show all 8 ]



Locus for Probe
barc204-6D
Type
Microsatellite
Chromosome
6D
Map
Wheat_Yr_2021-6D88.83
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Probe
BARC204
Possible Orthologs
Xbarc204
[ Show all 8 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.