Query (optional)   in Class  

GrainGenes Marker Report: GBMS0160

[ Submit comment/correction ]

Locus
GBMS0160
Type
Microsatellite
Chromosome
2H
Map
Barley, B73xCPI-2H71.7
Hordeum-Consensus2006-DArT-2H79.6
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Barley, Consensus 2006, DArT
Probe
GBMS160
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark
Number of populations contributing to the placement of GBMS0160 in the Barley, Consensus 2006 DArT maps = 1



Probe for Locus
GBMS160
Locus
GBMS0160
GBMS160
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
General Remarks
Insert contains repeat (GA)14
Primer sequences for this SSR are proprietary. Those interested should contact Marion Roeder.
Primer sequences for this SSR are proprietary, those interested should contact Marion Roeder
Type
PCR
SSR
PCR primers
Forward ATCCAGTGGCCTTTGTATGG
Reverse TCAGCTCCTCTCTCTTCATGTG
Source Species
Hordeum vulgare
Source Germplasm
Franka (barley)
Data Source
Roeder, Marion S.

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.