Query (optional)   in Class  

GrainGenes Marker Report: Xbarc122

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbarc122
Type
Microsatellite
Chromosome
5A
Map
Wheat-Composite2004-5A3
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
BARC122
Possible Orthologs
Xbarc122-2A
[ Show all 11 ]



Probe for Locus
BARC122
Locus
Xbarc122-2A
[ Show all 12 ]
General Remarks
Contains motif : (GA)17
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' CCCGTGTATATCCAGGAGTG 3'
5' CAGCCCTTGTGATGTGATG 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211327
Source Species
Triticum aestivum
Data Source
Ward, Rick