Query (optional)   in Class  

GrainGenes Marker Report: Xcfd190-6A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfd190-6A
Type
Microsatellite
Chromosome
6A
Map
Chinese_Spring_Deletion_SSR_6A-0.175
T.b.xT.m.-6A0
Ta-SSR-2004-6A37.1
Ta-Synthetic/Opata-GPW-6A69.2
[ Show Nearby Loci ]
Breakpoint Interval
C-6AS1-0.35
Map Data
T. boeoticum x monococcum
Wheat, Consensus SSR, 2004
Wheat, Physical, SSR
Wheat, Synthetic x Opata, GPW
Probe
CFD190
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xcfd190
[ Show all 7 ]



Probe for Locus
CFD190
Locus
Xcfd190-6A
[ Show all 8 ]
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CA)20
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' CAATCAGAAGCGCCATTGTT 3'
Reverse 5' CCCTGATGTTTTCTTTTTCTCC 3'
SSR size
191
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
6A
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre