Query (optional)   in Class  

GrainGenes Marker Report: Xmwg920-1A.1

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xmwg920-1A.1
Type
RFLP
Map
Tm-Dubcovsky2-1A-56.4
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
MWG920
Remark
In the population 'T. monococcum, DV92 x G3116,' this locus and Xmwg835-1A.1 were mapped with identical restriction fragments, so the corresponding clones are assumed to be homologous.
Possible Orthologs
[ Hide all but 1 of 13 ]
MWG920
MWG920-1A
MWG920-1B
MWG920.1A
MWG920.1a-5H
MWG920.1B
MWG920A
Xmwg920
Xmwg920-1A.2
Xmwg920-2A
Xmwg920-5A
Xmwg920.1
Xmwg920.2



Probe for Locus
MWG920
Locus
[ Hide all but 1 of 20 ]
MWG920
HD020D12
RI003F19
HI095K12
HI095K13
HD015M18
HD054L6
Xmwg920
MWG920-1A
MWG920-1B
MWG920A
Xmwg920-1A.1
Xmwg920-1A.2
Xmwg920-2A
Xmwg920-5A
MWG920.1B
MWG920.1A
Xmwg920.1
MWG920.1a-5H
Xmwg920.2
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' GTCACCGCCCGTCACGTTGCGCTTCA
5' GAGTACCGCGACCGTCGCGCTCGAGC
STS size
183
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234647
MWG920-5
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03