Query (optional)   in Class  

GrainGenes Marker Report: D008

[ Printable Version ]  [ Submit comment/correction ]

Locus
D008
Type
RFLP
Map
Tt-Gill-2D158.5
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD8
Possible Orthologs
XksuD8
XksuD8-2D



Probe for Locus
pTtksuD8
Locus
XksuD8
[ Show all 8 ]
Type
Genomic
STS
PCR primers
R:GGATGTCTCATATGCATGCAC
L:ACTGTCTGTGCCTTGTGATC
Specificity
Primer specificity verified, maps on chromosome 2BS.
Linkage Group
2D / 2D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.5
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09