Query (optional)   in Class  

GrainGenes Marker Report: D016

[ Printable Version ]  [ Submit comment/correction ]

Locus
D016
Type
RFLP
Map
Tt-Gill-5D209.6
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD16
Possible Orthologs
ksuD16
XksuD16
XksuD16-1D
XksuD16-6D
ksuD16a



Probe for Locus
pTtksuD16
Locus
XksuD16-6D
[ Show all 9 ]
Type
Genomic
STS
PCR primers
R:GAAGAACACGTGCGTGCACC
L:AAATCTGTCAGAGCCTGATGC
Linkage Group
5D / 1D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09