Query (optional)   in Class  

GrainGenes Marker Report: NAR7(B)

[ Printable Version ]  [ Submit comment/correction ]

Locus
NAR7(B)
Type
RFLP
Map
Hordeum-CxH-6H15.17
Hordeum-GxH-6H17.3
[ Show Nearby Loci ]
Map Data
Barley, CxH  Mapped_with_probe  NAR7
Barley, GxH  Mapped_with_probe  NAR7
Probe
NAR7



Probe for Locus
NAR7
Locus
Nar7
XNar7-6A
XNar7-6B
NAR7(B)
NAR7(A)
General Remarks
NAD(P)H nitrate reductase
Type
Genomic
STS
PCR primers
TCACCGAGTTGATGTTGAGC
TTCGACCTCTTCTCCTCCTC
Specificity
Does not map at Steptoe x Morex locus Nar7
Linkage Group
6L
Source Species
Hordeum vulgare
Insert Size
0.9
Clone Vector
pBS
Excision Enzyme
EcoRI
NotI
Clone Location
Kleinhofs, Andris
Clone Authority
Blake, Tom
Kleinhofs, Andris
Data Source
Blake, Tom93.04.09
ATMI92.09
Karakousis, Angelo96.10