Query (optional)   in Class  

GrainGenes Probe Report: ABC175

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC175  [ Marker Report ]
Locus
ABC175B
[ Show all 11 ]
Synonym
SynonymHAR35_1958
Type
cDNA
STS
STS primers
5' CAGTTTACAAGTGCAGAGGT
5' GAACAGAAGCAGAAGATCGA
STS size
270
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
BQ548059
ABC175-5
Source Species
Hordeum vulgare
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03