Query (optional)   in Class  

GrainGenes Probe Report: BA00383203_KASP

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Probe
BA00383203_KASP
Locus
AX-95149201
General Remarks
SNP = A51C
[ Show all 8 ]
Type
KASP
PCR primers
KASP primer A 5' atgaacacaatgggcttgcT
KASP primer B 5' atgaacacaatgggcttgcG
KASP Common Primer 5' tcttcatccagtgccgcttt
Source Species
Triticum aestivum

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.