Query (optional)   in Class  

GrainGenes Probe Report: BJ251715-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BJ251715-3B
Data at Wheat_SNP
BJ251715-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS at 184,17
SNP A>T at 200
Reference sequence TTAGGTTTGGATGGCTTTTGCACAGGTGGATGAATAAGACTCAATGCTTTGTTCAGGGAATCAGCGAGGACACTAAGGTGACTACTAAGCACATCAGATTCTATGTCCTGCAAAGGTAAATATGTCAGATAACAATGAATATATGGGAAGATTGATGTTGCAGTCTAAAGAAGGTGGCAGTCTAAAATGAACAGCTGGGATAACAATATAGCTGGCAGTCTAAAGAAGGTGGCAGCAGTGGTCAGAATCAAGCGACATACCATGTTGCCAAAATGAACAGCTCCTGCCAAATGGTTAACTTTCATAGCAACAAAATTGTGCTTGACAGCATCAACAGCGATCTTCTCCACGACA
Type
EST
SNP
PCR primers
BJ251715B_F1_UMN TAGGTTTGGATGGCTTTTGC
BJ251715B_R1_UMN GTCGTGGAGAAGATCGCTGT
Sequence
BJ251715
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01