Query (optional)   in Class  

GrainGenes Probe Report: CNL62

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
CNL62  [ Marker Report ]
Locus
Xcnl62-5B
Xcnl62-3B
cnl62-3B
cnl62
Type
PCR
PCR primers
Forward CCATTCTACTCAACGCAAAGTC
Reverse CGTCTTCTTGTCCAGCTCGT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.