Query (optional)   in Class  

GrainGenes Probe Report: GPW5281

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW5281  [ Marker Report ]
Locus
Xgpw5281-2A
Xgpw5281-3D
Xgpw5281-5D
General Remarks
Motif (AG)15(GAG)6.7
Type
PCR
SSR
PCR primers
Forward TTCGTTCATATTGTCCCGGT
Forward TTCGTTCATATTGTCCCGGT
Reverse TAGTGCTACAGATCCGCCG
Reverse TAGTGCTACAGATCCGCCG
SSR size
Expected 314
Amplification Conditions
Tm = 60C
Linkage Group
2A/3D/5D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre2009.09