Query (optional)   in Class  

GrainGenes Probe Report: GPW7240

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7240
General Remarks
Motif (CCA)7
Type
PCR
SSR
PCR primers
Forward GTCCTCGCAGCTCTTCCTC
Forward GTCCTCGCAGCTCTTCCTC
Reverse AGAAGGTGTTGCTTACCTCTGC
Reverse AGAAGGTGTTGCTTACCTCTGC
SSR size
Expected 113
Amplification Conditions
Tm = 60C
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09