Query (optional)   in Class  

GrainGenes Probe Report: GPW7384

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7384  [ Marker Report ]
Locus
Xgpw7384-6A
General Remarks
Motif (AGC)5(GCTC)3
Type
PCR
SSR
PCR primers
Forward CCCACCTCCGATCTCTATCC
Forward CCCACCTCCGATCTCTATCC
Reverse AGCCGTGGTACTCGTGATG
Reverse AGCCGTGGTACTCGTGATG
SSR size
Expected 222
Amplification Conditions
Tm = 60C
Linkage Group
6A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09