Query (optional)   in Class  

GrainGenes Probe Report: GPW94019

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94019
General Remarks
Motif (CT)27
Type
PCR
SSR
PCR primers
Forward AAGACCCGAACAACCTTGC
Reverse TCTACTAATGGGAGTGGATGCC
SSR size
129
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre