Query (optional)   in Class  

GrainGenes Sequence Report: BS00090069_51

[Submit comment/correction]

Sequence
BS00090069_51
Contig
6BS_2994924
Probe
BS00090069_51
DNA Homology
6BS_2994924Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446BS_2994924Best IWGSC match
DNA
caaaccgccaaagcatgttcatatagtcccttgaaaacagagtgttcatg
Matcctgagctgatgatgcaactgaaattacagaaagaagcgcacacacc
a
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.