Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_rep_c55507_100

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_rep_c55507_100
Contig
1DS_617469
Probe
BobWhite_rep_c55507_100
DNA Homology
1DS_617469Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441DS_617469Best IWGSC match
DNA
ttcaaggcagaaaggaaacctgacctctgggccatcttggctgcactggg
Rcggtgggcagtatttgaagaaatcttgatcatcccatgccgtggccaag
t
BLAST
BLAST Search