Query (optional)   in Class  

GrainGenes Sequence Report: CMWG728-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CMWG728-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
cMWG728
DNA Homology
AA979912502corn_EST
[ Show all 91 ]
DNA
tggccgtcgtcgagtcgcgccggccgagcggcaccgcccaggtgggcccg
cctagcagcaccgtgccgtcccgtgctgcgagggcggcgatgtcggcgca
ggagacgatgccggggcagagcagctccacgttccgcttgatctggtcga
tcacctcgtagccccgccg
BLAST
BLAST Search