Query (optional)   in Class  

GrainGenes Sequence Report: Ta.14635.3.S1_x_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.14635.3.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
AJ612463
[ Show all 50 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE518393
DNA
aacagctactgcgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ngnnnnnnnncccnctnnnnnnnatgtcgaagcgagggcgcggaggttcn
gctggtaacaagttccggatgtcgctgggtctgccggtggcagccactgt
caactgtgctgacaacactggtgccaagaacctgtacatcatctccgtga
agggaatcaaggggcgcctcaacaggcttccttctgcctgcgttggtgac
atggttatggccactgtcaagaagggaaagcctgacctcaggaagaaggt
catgccggctgtcatcgtcaggcagcgcaagccgtggcgccgaaaggacg
gtgtcttcatgtactttgaagacaatgctggagtcattgtgaacccaaag
ggagagatgaaaggttctgccatcactggaccgatcgggaaggagtgcgc
cgacctgtggcccaggattgccagcgccgcgaatgccatcgtctgatctg
atcgccggagcagctagatgatcaaagcntttgatagcatgtccctcttt
tcttctagtttnnnacttgtggcccttgaggatgagtttcctggattatg
taatgctgctggattatngtctgttagntttnnnnnagattttgcactgt
ggtttggctnctnannnnnnnnttgntnangtttganacctgaaagagct
tttgatcggatttatctctgttgtngnnnnnnannnannnnnnannnnnn
nnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnanannnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BLAST
BLAST Search